Rat WFS1(Wolfram Syndrome Protein 1) ELISA Kit

Rat WFS1(Wolfram Syndrome Protein 1) ELISA Kit

To Order Contact us: [email protected]

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

RD-WFS1-Ra-96Tests 96 Tests
EUR 840

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

DLR-WFS1-Hu-48T 48T
EUR 554
  • Should the Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

DLR-WFS1-Hu-96T 96T
EUR 725
  • Should the Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

DLR-WFS1-Mu-48T 48T
EUR 566
  • Should the Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

DLR-WFS1-Mu-96T 96T
EUR 741
  • Should the Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

RDR-WFS1-Hu-48Tests 48 Tests
EUR 589

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

RDR-WFS1-Hu-96Tests 96 Tests
EUR 820

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

RDR-WFS1-Mu-48Tests 48 Tests
EUR 603

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

RDR-WFS1-Mu-96Tests 96 Tests
EUR 840

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

RD-WFS1-Hu-48Tests 48 Tests
EUR 563

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

RD-WFS1-Hu-96Tests 96 Tests
EUR 783

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

RD-WFS1-Mu-48Tests 48 Tests
EUR 577

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

RD-WFS1-Mu-96Tests 96 Tests
EUR 802

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

20-abx156234
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Wolfram Syndrome Protein 1(WFS1)ELISA Kit

QY-E10091 96T
EUR 361

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Ra-10x96wellstestplate 10x96-wells test plate
EUR 5621.62
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Ra-1x48wellstestplate 1x48-wells test plate
EUR 550.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Ra-1x96wellstestplate 1x96-wells test plate
EUR 743.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Ra-5x96wellstestplate 5x96-wells test plate
EUR 3046.74
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

4-SEL118Ra
  • EUR 5672.00
  • EUR 2997.00
  • EUR 744.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Wolfram Syndrome Protein 1 elisa. Alternative names of the recognized antigen: DFNA14
  • DFNA38
  • DFNA6
  • DIDMOAD
  • WFRS
  • WFS
  • Wolframin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Wolfram Syndrome Protein 1 (WFS1) Protein

20-abx655529
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Wolfram Syndrome Protein 1 (WFS1) Antibody

20-abx178933
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Wolfram Syndrome Protein 1 (WFS1) Antibody

20-abx178934
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Wolfram Syndrome Protein 1 (WFS1) Antibody

20-abx178935
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Wolfram Syndrome Protein 1 (WFS1) Antibody

20-abx178936
  • EUR 1414.00
  • EUR 662.00
  • 1 mg
  • 200 ug
  • Please enquire.

Wolfram Syndrome Protein 1 (WFS1) Antibody

20-abx175148
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Wolfram Syndrome Protein 1 (WFS1) Antibody

20-abx175149
  • EUR 982.00
  • EUR 495.00
  • 1 mg
  • 200 ug
  • Please enquire.

Rat Wolfram Syndrome Protein 1 (WFS1) CLIA Kit

20-abx190772
  • EUR 8443.00
  • EUR 4497.00
  • EUR 1036.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Ra-10x96wellstestplate 10x96-wells test plate
EUR 6119.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Ra-1x48wellstestplate 1x48-wells test plate
EUR 591.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Ra-1x96wellstestplate 1x96-wells test plate
EUR 802.24
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Ra-5x96wellstestplate 5x96-wells test plate
EUR 3310.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1) CLIA Kit

4-SCL118Ra
  • EUR 6170.00
  • EUR 3311.00
  • EUR 803.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Wolfram Syndrome Protein 1 Clia kit. Alternative names of the recognized antigen: DFNA14
  • DFNA38
  • DFNA6
  • DIDMOAD
  • WFRS
  • WFS
  • Wolframin
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Rat Wolfram Syndrome Protein 1 (WFS1)Tissue homogenates and other biological fluids

ELISA kit for Rat WFS1 (Wolfram Syndrome Protein 1)

ELK7982 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Wolfram Syndrome Protein 1 (WFS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Wolfram Syndrome Protein 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

20-abx153499
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

20-abx154862
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Wolfram Syndrome Protein 1(WFS1)ELISA Kit

GA-E0015HM-48T 48T
EUR 289

Human Wolfram Syndrome Protein 1(WFS1)ELISA Kit

GA-E0015HM-96T 96T
EUR 466

Human Wolfram Syndrome Protein 1(WFS1)ELISA Kit

QY-E04478 96T
EUR 361

Mouse Wolfram Syndrome Protein 1(WFS1)ELISA Kit

QY-E21631 96T
EUR 361

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

4-SEL118Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Wolfram Syndrome Protein 1 elisa. Alternative names of the recognized antigen: DFNA14
  • DFNA38
  • DFNA6
  • DIDMOAD
  • WFRS
  • WFS
  • Wolframin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Wolfram Syndrome Protein 1 (WFS1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

SEL118Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit

4-SEL118Mu
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Wolfram Syndrome Protein 1 elisa. Alternative names of the recognized antigen: DFNA14
  • DFNA38
  • DFNA6
  • DIDMOAD
  • WFRS
  • WFS
  • Wolframin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Wolfram Syndrome Protein 1 (WFS1) Protein

20-abx655526
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Wolfram Syndrome Protein 1 (WFS1) Protein

20-abx655527
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Wolfram Syndrome Protein 1 (WFS1) Protein

20-abx655528
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Wolfram Syndrome Protein 1 (WFS1) CLIA Kit

20-abx190368
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Wolfram Syndrome Protein 1 (WFS1) CLIA Kit

20-abx190587
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) CLIA Kit

4-SCL118Hu
  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Wolfram Syndrome Protein 1 Clia kit. Alternative names of the recognized antigen: DFNA14
  • DFNA38
  • DFNA6
  • DIDMOAD
  • WFRS
  • WFS
  • Wolframin
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Wolfram Syndrome Protein 1 (WFS1)Tissue homogenates and other biological fluids

Mouse Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Mu-10x96wellstestplate 10x96-wells test plate
EUR 5804.88
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Mu-1x48wellstestplate 1x48-wells test plate
EUR 565.7
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Mu-1x96wellstestplate 1x96-wells test plate
EUR 765.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1)CLIA Kit

SCL118Mu-5x96wellstestplate 5x96-wells test plate
EUR 3143.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) CLIA Kit

4-SCL118Mu
  • EUR 5855.00
  • EUR 3144.00
  • EUR 766.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Wolfram Syndrome Protein 1 Clia kit. Alternative names of the recognized antigen: DFNA14
  • DFNA38
  • DFNA6
  • DIDMOAD
  • WFRS
  • WFS
  • Wolframin
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1)Tissue homogenates and other biological fluids

ELISA kit for Human WFS1 (Wolfram Syndrome Protein 1)

ELK6587 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Wolfram Syndrome Protein 1 (WFS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Wolfram Syndrome Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse WFS1 (Wolfram Syndrome Protein 1)

ELK7981 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Wolfram Syndrome Protein 1 (WFS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Wolfram Syndrome Protein 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Wolfram Syndrome Protein 1 ELISA Kit

ELA-E2399h 96 Tests
EUR 824

Wolfram Syndrome 1 (Wolframin) Polyclonal Antibody

20-abx116958
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

WFS1 ELISA KIT|Human

EF004293 96 Tests
EUR 689

Rat Alstrom syndrome protein 1(ALMS1) ELISA kit

E02A1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alstrom syndrome protein 1(ALMS1) ELISA kit

E02A1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alstrom syndrome protein 1(ALMS1) ELISA kit

E02A1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Wolframin, WFS1 ELISA KIT

ELI-14964h 96 Tests
EUR 824

Mouse Wolframin, Wfs1 ELISA KIT

ELI-40468m 96 Tests
EUR 865

Rat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E02H0371-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E02H0371-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E02H0371-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bloom syndrome protein(BLM) ELISA kit

E02B0804-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bloom syndrome protein(BLM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bloom syndrome protein(BLM) ELISA kit

E02B0804-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bloom syndrome protein(BLM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bloom syndrome protein(BLM) ELISA kit

E02B0804-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bloom syndrome protein(BLM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Toxic shock syndrome toxin 1 ELISA kit

E02T0564-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Toxic shock syndrome toxin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Toxic shock syndrome toxin 1 ELISA kit

E02T0564-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Toxic shock syndrome toxin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Toxic shock syndrome toxin 1 ELISA kit

E02T0564-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Toxic shock syndrome toxin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat AMME syndrome candidate gene 1 protein(AMMECR1) ELISA kit

E02A1424-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat AMME syndrome candidate gene 1 protein(AMMECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat AMME syndrome candidate gene 1 protein(AMMECR1) ELISA kit

E02A1424-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat AMME syndrome candidate gene 1 protein(AMMECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat AMME syndrome candidate gene 1 protein(AMMECR1) ELISA kit

E02A1424-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat AMME syndrome candidate gene 1 protein(AMMECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Meckel syndrome type 1 protein (MKS1)

KTE100610-48T 48T
EUR 332
  • The protein encoded by MKS1 localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in MKS1 result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript var
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Meckel syndrome type 1 protein (MKS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Meckel syndrome type 1 protein (MKS1)

KTE100610-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by MKS1 localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in MKS1 result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript var
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Meckel syndrome type 1 protein (MKS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Meckel syndrome type 1 protein (MKS1)

KTE100610-96T 96T
EUR 539
  • The protein encoded by MKS1 localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in MKS1 result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript var
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Meckel syndrome type 1 protein (MKS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Myelodysplasia Syndrome 1 Cell ELISA Kit

abx595832-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

ELISA kit for Mouse Wolframin (WFS1)

KTE70013-48T 48T
EUR 332
  • Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Wolframin (WFS1)

KTE70013-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Wolframin (WFS1)

KTE70013-96T 96T
EUR 539
  • Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Wolframin (WFS1)

KTE60034-48T 48T
EUR 332
  • Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Wolframin (WFS1)

KTE60034-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Wolframin (WFS1)

KTE60034-96T 96T
EUR 539
  • Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

WFS1 antibody

70R-21319 50 ul
EUR 435
Description: Rabbit polyclonal WFS1 antibody

WFS1 antibody

38285-100ul 100ul
EUR 252

WFS1 Antibody

43590-100ul 100ul
EUR 252

WFS1 Antibody

DF6566 200ul
EUR 304
Description: WFS1 Antibody detects endogenous levels of total WFS1.

WFS1 Antibody

1-CSB-PA026100GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against WFS1. Recognizes WFS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

WFS1 antibody

70R-50550 100 ul
EUR 244
Description: Purified Polyclonal WFS1 antibody

WFS1 siRNA

20-abx939839
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WFS1 siRNA

20-abx939840
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WFS1 Antibody

ABD6566 100 ug
EUR 438

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Wfs1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6999602 1.0 ug DNA
EUR 154

Human Alstrom syndrome protein 1(ALMS1) ELISA kit

E01A1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alstrom syndrome protein 1(ALMS1) ELISA kit

E01A1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alstrom syndrome protein 1(ALMS1) ELISA kit

E01A1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alstrom syndrome protein 1(ALMS1) ELISA kit

E06A1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alstrom syndrome protein 1(ALMS1) ELISA kit

E06A1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alstrom syndrome protein 1(ALMS1) ELISA kit

E06A1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alstrom syndrome protein 1(ALMS1) ELISA kit

E03A1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alstrom syndrome protein 1(ALMS1) ELISA kit

E03A1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alstrom syndrome protein 1(ALMS1) ELISA kit

E03A1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alstrom syndrome protein 1(ALMS1) ELISA kit

E04A1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alstrom syndrome protein 1(ALMS1) ELISA kit

E04A1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alstrom syndrome protein 1(ALMS1) ELISA kit

E04A1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alstrom syndrome protein 1(ALMS1) ELISA kit

E07A1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alstrom syndrome protein 1(ALMS1) ELISA kit

E07A1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alstrom syndrome protein 1(ALMS1) ELISA kit

E07A1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alstrom syndrome protein 1(ALMS1) ELISA kit

E08A1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alstrom syndrome protein 1(ALMS1) ELISA kit

E08A1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alstrom syndrome protein 1(ALMS1) ELISA kit

E08A1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alstrom syndrome protein 1(ALMS1) ELISA kit

E09A1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alstrom syndrome protein 1(ALMS1) ELISA kit

E09A1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alstrom syndrome protein 1(ALMS1) ELISA kit

E09A1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alstrom syndrome protein 1, ALMS1 ELISA KIT

ELI-11542h 96 Tests
EUR 824

Human Hydrolethalus syndrome protein 1, HYLS1 ELISA KIT

ELI-42181h 96 Tests
EUR 824

Human Alstrom syndrome protein 1(ALMS1) ELISA kit

CSB-EL001616HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Alstrom syndrome protein 1 (ALMS1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Alstrom syndrome protein 1(ALMS1) ELISA kit

1-CSB-EL001616HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Alstrom syndrome protein 1(ALMS1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Alstrom syndrome protein 1 (ALMS1) ELISA Kit

abx384573-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Alstrom syndrome protein 1 (ALMS1) ELISA Kit

abx388564-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Alms1 ELISA Kit| Mouse Alstrom syndrome protein 1 ELISA Kit

EF014189 96 Tests
EUR 689

Wfs1 ORF Vector (Rat) (pORF)

ORF079137 1.0 ug DNA
EUR 506

WFS1 Protein Vector (Rat) (pPB-C-His)

PV316546 500 ng
EUR 1166

WFS1 Protein Vector (Rat) (pPB-N-His)

PV316547 500 ng
EUR 1166

WFS1 Protein Vector (Rat) (pPM-C-HA)

PV316548 500 ng
EUR 1166

WFS1 Protein Vector (Rat) (pPM-C-His)

PV316549 500 ng
EUR 1166

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Human Fraser Syndrome 1 (FRAS1) ELISA Kit

abx384928-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Fraser Syndrome 1 (FRAS1) ELISA Kit

abx389338-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E03H0371-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E03H0371-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E03H0371-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alstrom syndrome protein 1(ALMS1) ELISA kit

E05A1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alstrom syndrome protein 1(ALMS1) ELISA kit

E05A1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alstrom syndrome protein 1(ALMS1) ELISA kit

E05A1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E04H0371-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E04H0371-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E04H0371-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E06H0371-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E06H0371-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E06H0371-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E01H0371-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E01H0371-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E01H0371-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E09H0371-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E09H0371-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E09H0371-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E08H0371-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E08H0371-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E08H0371-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Meckel syndrome type 1 protein, MKS1 ELISA KIT

ELI-15768h 96 Tests
EUR 824

Human Hermansky- Pudlak syndrome 1 protein, HPS1 ELISA KIT

ELI-20317h 96 Tests
EUR 824

Mouse Hydrolethalus syndrome protein 1 homolog, Hyls1 ELISA KIT

ELI-07934m 96 Tests
EUR 865

Pig Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E07H0371-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E07H0371-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit

E07H0371-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Hyls1 ELISA Kit| Mouse Hydrolethalus syndrome protein 1 homolog

EF015209 96 Tests
EUR 689

HYLS1 ELISA Kit| Bovine Hydrolethalus syndrome protein 1 homolo

EF011505 96 Tests
EUR 689

Human Hydrolethalus Syndrome Protein 1 Homolog (HYLS1) ELISA Kit

abx385018-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Hermansky-Pudlak Syndrome 1 Protein (HPS1) ELISA Kit

abx387875-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Hydrolethalus Syndrome Protein 1 Homolog (HYLS1) ELISA Kit

abx389575-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Alstrom syndrome protein 1 homolog, Alms1 ELISA KIT

ELI-34548m 96 Tests
EUR 865

Human Bardet- Biedl syndrome 1 protein, BBS1 ELISA KIT

ELI-34728h 96 Tests
EUR 824

Bovine Hydrolethalus syndrome protein 1 homolog, HYLS1 ELISA KIT

ELI-48283b 96 Tests
EUR 928

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Rat TIMP-1 AssayMax ELISA Kit

ERT2538-1 96 Well Plate
EUR 477

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Rat Hermansky Pudlak syndrome 2 protein(HPS2) ELISA kit

E02H0372-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 2 protein(HPS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 2 protein(HPS2) ELISA kit

E02H0372-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 2 protein(HPS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 2 protein(HPS2) ELISA kit

E02H0372-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 2 protein(HPS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 3 protein(HPS3) ELISA kit

E02H0373-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 3 protein(HPS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 3 protein(HPS3) ELISA kit

E02H0373-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 3 protein(HPS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 3 protein(HPS3) ELISA kit

E02H0373-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 3 protein(HPS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 4 protein(HPS4) ELISA kit

E02H0374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 4 protein(HPS4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 4 protein(HPS4) ELISA kit

E02H0374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 4 protein(HPS4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 4 protein(HPS4) ELISA kit

E02H0374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 4 protein(HPS4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 5 protein(HPS5) ELISA kit

E02H0375-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 5 protein(HPS5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 5 protein(HPS5) ELISA kit

E02H0375-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 5 protein(HPS5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 5 protein(HPS5) ELISA kit

E02H0375-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 5 protein(HPS5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 6 protein(HPS6) ELISA kit

E02H0376-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 6 protein(HPS6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 6 protein(HPS6) ELISA kit

E02H0376-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 6 protein(HPS6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 6 protein(HPS6) ELISA kit

E02H0376-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 6 protein(HPS6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neural Wiskott-Aldrich syndrome protein (WASL) ELISA Kit

abx392121-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

WFS1 Blocking Peptide

DF6566-BP 1mg
EUR 195

Wolframin (WFS1) Antibody

20-abx008572
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Wolframin (WFS1) Antibody

abx036709-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

WFS1 Blocking Peptide

20-abx063425
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Wolframin (WFS1) Antibody

abx239509-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

WFS1 Conjugated Antibody

C43590 100ul
EUR 397

WFS1 cloning plasmid

CSB-CL026100HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2673
  • Sequence: atggactccaacactgctccgctgggcccctcctgcccacagcccccgccagcaccgcagccccaggcgcgttcccgactcaatgccacagcctcgttggagcaggagaggagcgaaaggccccgagcacccggaccccaggctggccctggccctggtgttagagacgcagcgg
  • Show more
Description: A cloning plasmid for the WFS1 gene.

WFS1 Rabbit pAb

A1705-100ul 100 ul
EUR 308

WFS1 Rabbit pAb

A1705-200ul 200 ul
EUR 459

WFS1 Rabbit pAb

A1705-20ul 20 ul
EUR 183

WFS1 Rabbit pAb

A1705-50ul 50 ul
EUR 223

WFS1 Polyclonal Antibody

ABP60915-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human WFS1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of WFS1 from Human, Mouse. This WFS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WFS1 protein

WFS1 Polyclonal Antibody

ABP60915-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human WFS1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of WFS1 from Human, Mouse. This WFS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WFS1 protein

WFS1 Polyclonal Antibody

ABP60915-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human WFS1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of WFS1 from Human, Mouse. This WFS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WFS1 protein

Wolframin (WFS1) Antibody

20-abx001429
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti- WFS1 antibody

FNab09509 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:50-1:500
  • IF: 1:50-1:200
  • Immunogen: Wolfram syndrome 1(wolframin)
  • Uniprot ID: O76024
  • Gene ID: 7466
  • Research Area: Neuroscience
Description: Antibody raised against WFS1

WFS1 Polyclonal Antibody

ES11949-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WFS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

WFS1 Polyclonal Antibody

ES11949-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WFS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Recombinant human WFS1

P1940 100ug Ask for price
  • Uniprot ID: O76024
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human WFS1

Anti-WFS1 antibody

PAab09509 100 ug
EUR 386

Rat WFS1(Wolfram Syndrome Protein 1) ELISA Kit