Rat WFS1(Wolfram Syndrome Protein 1) ELISA Kit

Rat WFS1(Wolfram Syndrome Protein 1) ELISA Kit

To Order Contact us: [email protected]

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
RD-WFS1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 840

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
DLR-WFS1-Hu-48T	DL Develop	48T	EUR 554
Should the Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
DLR-WFS1-Hu-96T	DL Develop	96T	EUR 725
Should the Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
DLR-WFS1-Mu-48T	DL Develop	48T	EUR 566
Should the Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
DLR-WFS1-Mu-96T	DL Develop	96T	EUR 741
Should the Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
RDR-WFS1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
RDR-WFS1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
RDR-WFS1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 603

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
RDR-WFS1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 840

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
RD-WFS1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
RD-WFS1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
RD-WFS1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 577

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
RD-WFS1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
20-abx156234	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Wolfram Syndrome Protein 1(WFS1)ELISA Kit
QY-E10091	Qayee Biotechnology	96T	EUR 361

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5621.62
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 550.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 743.72
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3046.74
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
4-SEL118Ra	Cloud-Clone	EUR 5672.00 EUR 2997.00 EUR 744.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Wolfram Syndrome Protein 1 elisa. Alternative names of the recognized antigen: DFNA14 DFNA38 DFNA6 DIDMOAD WFRS WFS Wolframin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Wolfram Syndrome Protein 1 (WFS1) Protein
20-abx655529	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Wolfram Syndrome Protein 1 (WFS1) Antibody
20-abx178933	Abbexa	EUR 1316.00 EUR 620.00	1 mg 200 ug
Please enquire.

Wolfram Syndrome Protein 1 (WFS1) Antibody
20-abx178934	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Wolfram Syndrome Protein 1 (WFS1) Antibody
20-abx178935	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Wolfram Syndrome Protein 1 (WFS1) Antibody
20-abx178936	Abbexa	EUR 1414.00 EUR 662.00	1 mg 200 ug
Please enquire.

Wolfram Syndrome Protein 1 (WFS1) Antibody
20-abx175148	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Wolfram Syndrome Protein 1 (WFS1) Antibody
20-abx175149	Abbexa	EUR 982.00 EUR 495.00	1 mg 200 ug
Please enquire.

Rat Wolfram Syndrome Protein 1 (WFS1) CLIA Kit
20-abx190772	Abbexa	EUR 8443.00 EUR 4497.00 EUR 1036.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 6119.04
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 591.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 802.24
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3310.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Rat Wolfram Syndrome Protein 1 (WFS1) CLIA Kit
4-SCL118Ra	Cloud-Clone	EUR 6170.00 EUR 3311.00 EUR 803.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Wolfram Syndrome Protein 1 Clia kit. Alternative names of the recognized antigen: DFNA14 DFNA38 DFNA6 DIDMOAD WFRS WFS Wolframin
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Rat Wolfram Syndrome Protein 1 (WFS1)Tissue homogenates and other biological fluids

ELISA kit for Rat WFS1 (Wolfram Syndrome Protein 1)
ELK7982	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Wolfram Syndrome Protein 1 (WFS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Wolfram Syndrome Protein 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
20-abx153499	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
20-abx154862	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Wolfram Syndrome Protein 1(WFS1)ELISA Kit
GA-E0015HM-48T	GenAsia Biotech	48T	EUR 289

Human Wolfram Syndrome Protein 1(WFS1)ELISA Kit
GA-E0015HM-96T	GenAsia Biotech	96T	EUR 466

Human Wolfram Syndrome Protein 1(WFS1)ELISA Kit
QY-E04478	Qayee Biotechnology	96T	EUR 361

Mouse Wolfram Syndrome Protein 1(WFS1)ELISA Kit
QY-E21631	Qayee Biotechnology	96T	EUR 361

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
4-SEL118Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Wolfram Syndrome Protein 1 elisa. Alternative names of the recognized antigen: DFNA14 DFNA38 DFNA6 DIDMOAD WFRS WFS Wolframin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Wolfram Syndrome Protein 1 (WFS1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5333.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 526.89
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 709.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
SEL118Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2894.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
4-SEL118Mu	Cloud-Clone	EUR 5384.00 EUR 2845.00 EUR 710.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Wolfram Syndrome Protein 1 elisa. Alternative names of the recognized antigen: DFNA14 DFNA38 DFNA6 DIDMOAD WFRS WFS Wolframin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Wolfram Syndrome Protein 1 (WFS1) Protein
20-abx655526	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Wolfram Syndrome Protein 1 (WFS1) Protein
20-abx655527	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Wolfram Syndrome Protein 1 (WFS1) Protein
20-abx655528	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Wolfram Syndrome Protein 1 (WFS1) CLIA Kit
20-abx190368	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Wolfram Syndrome Protein 1 (WFS1) CLIA Kit
20-abx190587	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Human Wolfram Syndrome Protein 1 (WFS1) CLIA Kit
4-SCL118Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Wolfram Syndrome Protein 1 Clia kit. Alternative names of the recognized antigen: DFNA14 DFNA38 DFNA6 DIDMOAD WFRS WFS Wolframin
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Wolfram Syndrome Protein 1 (WFS1)Tissue homogenates and other biological fluids

Mouse Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5804.88
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 565.7
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 765.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1)CLIA Kit
SCL118Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3143.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Wolfram Syndrome Protein 1 (WFS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in Tissue homogenates and other biological fluids.

Mouse Wolfram Syndrome Protein 1 (WFS1) CLIA Kit
4-SCL118Mu	Cloud-Clone	EUR 5855.00 EUR 3144.00 EUR 766.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Wolfram Syndrome Protein 1 Clia kit. Alternative names of the recognized antigen: DFNA14 DFNA38 DFNA6 DIDMOAD WFRS WFS Wolframin
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Mouse Wolfram Syndrome Protein 1 (WFS1)Tissue homogenates and other biological fluids

ELISA kit for Human WFS1 (Wolfram Syndrome Protein 1)
ELK6587	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Wolfram Syndrome Protein 1 (WFS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Wolfram Syndrome Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse WFS1 (Wolfram Syndrome Protein 1)
ELK7981	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Wolfram Syndrome Protein 1 (WFS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Wolfram Syndrome Protein 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Wolfram Syndrome Protein 1 ELISA Kit
ELA-E2399h	Lifescience Market	96 Tests	EUR 824

Wolfram Syndrome 1 (Wolframin) Polyclonal Antibody
20-abx116958	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

WFS1 ELISA Kit (Rat) (OKCD09279)
OKCD09279	Aviva Systems Biology	96 Wells	EUR 1157
Description: Description of target: endoplasmic reticulum membrane glycoprotein; postulated to be involved in neuronal membrane trafficking or protein processing.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.118ng/mL

WFS1 ELISA KIT\|Human
EF004293	Lifescience Market	96 Tests	EUR 689

Rat Alstrom syndrome protein 1(ALMS1) ELISA kit
E02A1397-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alstrom syndrome protein 1(ALMS1) ELISA kit
E02A1397-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alstrom syndrome protein 1(ALMS1) ELISA kit
E02A1397-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

WFS1 Chemi-Luminescent ELISA Kit (Rat) (OKCD04028)
OKCD04028	Aviva Systems Biology	96 Wells	EUR 1066
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Human Wolframin, WFS1 ELISA KIT
ELI-14964h	Lifescience Market	96 Tests	EUR 824

Mouse Wolframin, Wfs1 ELISA KIT
ELI-40468m	Lifescience Market	96 Tests	EUR 865

WFS1 ELISA Kit (Human) (OKCD02035)
OKCD02035	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Participates in the regulation of cellular Ca2+ homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca2+ store.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.103 ng/mL

Wfs1 ELISA Kit (Mouse) (OKCD02036)
OKCD02036	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: Participates in the regulation of cellular Ca2+ homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca2+ store.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.133 ng/mL

Rat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E02H0371-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E02H0371-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E02H0371-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bloom syndrome protein(BLM) ELISA kit
E02B0804-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bloom syndrome protein(BLM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bloom syndrome protein(BLM) ELISA kit
E02B0804-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bloom syndrome protein(BLM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bloom syndrome protein(BLM) ELISA kit
E02B0804-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bloom syndrome protein(BLM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Toxic shock syndrome toxin 1 ELISA kit
E02T0564-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Toxic shock syndrome toxin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Toxic shock syndrome toxin 1 ELISA kit
E02T0564-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Toxic shock syndrome toxin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Toxic shock syndrome toxin 1 ELISA kit
E02T0564-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Toxic shock syndrome toxin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat AMME syndrome candidate gene 1 protein(AMMECR1) ELISA kit
E02A1424-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat AMME syndrome candidate gene 1 protein(AMMECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat AMME syndrome candidate gene 1 protein(AMMECR1) ELISA kit
E02A1424-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat AMME syndrome candidate gene 1 protein(AMMECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat AMME syndrome candidate gene 1 protein(AMMECR1) ELISA kit
E02A1424-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat AMME syndrome candidate gene 1 protein(AMMECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Meckel syndrome type 1 protein (MKS1)
KTE100610-48T	Abbkine	48T	EUR 332
The protein encoded by MKS1 localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in MKS1 result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript var Show more
Description: Quantitative sandwich ELISA for measuring Rat Meckel syndrome type 1 protein (MKS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Meckel syndrome type 1 protein (MKS1)
KTE100610-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The protein encoded by MKS1 localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in MKS1 result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript var Show more
Description: Quantitative sandwich ELISA for measuring Rat Meckel syndrome type 1 protein (MKS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Meckel syndrome type 1 protein (MKS1)
KTE100610-96T	Abbkine	96T	EUR 539
The protein encoded by MKS1 localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in MKS1 result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript var Show more
Description: Quantitative sandwich ELISA for measuring Rat Meckel syndrome type 1 protein (MKS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Myelodysplasia Syndrome 1 Cell ELISA Kit
abx595832-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

WFS1 antibody
70R-21319	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal WFS1 antibody

WFS1 antibody
38285-100ul	SAB	100ul	EUR 252

WFS1 Antibody
43590-100ul	SAB	100ul	EUR 252

WFS1 Antibody
DF6566	Affbiotech	200ul	EUR 304
Description: WFS1 Antibody detects endogenous levels of total WFS1.

WFS1 Antibody
1-CSB-PA026100GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against WFS1. Recognizes WFS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

WFS1 antibody
70R-50550	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal WFS1 antibody

WFS1 siRNA
20-abx939839	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

WFS1 siRNA
20-abx939840	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

WFS1 Antibody
ABD6566	Lifescience Market	100 ug	EUR 438

ELISA kit for Mouse Wolframin (WFS1)
KTE70013-48T	Abbkine	48T	EUR 332
Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured Show more
Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Wolframin (WFS1)
KTE70013-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured Show more
Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Wolframin (WFS1)
KTE70013-96T	Abbkine	96T	EUR 539
Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured Show more
Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Wolframin (WFS1)
KTE60034-48T	Abbkine	48T	EUR 332
Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres Show more
Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Wolframin (WFS1)
KTE60034-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres Show more
Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Wolframin (WFS1)
KTE60034-96T	Abbkine	96T	EUR 539
Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres Show more
Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Wfs1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6999602	ABM	1.0 ug DNA	EUR 154

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human Alstrom syndrome protein 1(ALMS1) ELISA kit
E01A1397-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alstrom syndrome protein 1(ALMS1) ELISA kit
E01A1397-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alstrom syndrome protein 1(ALMS1) ELISA kit
E01A1397-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alstrom syndrome protein 1(ALMS1) ELISA kit
E06A1397-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alstrom syndrome protein 1(ALMS1) ELISA kit
E06A1397-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alstrom syndrome protein 1(ALMS1) ELISA kit
E06A1397-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alstrom syndrome protein 1(ALMS1) ELISA kit
E03A1397-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alstrom syndrome protein 1(ALMS1) ELISA kit
E03A1397-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alstrom syndrome protein 1(ALMS1) ELISA kit
E03A1397-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alstrom syndrome protein 1(ALMS1) ELISA kit
E04A1397-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alstrom syndrome protein 1(ALMS1) ELISA kit
E04A1397-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alstrom syndrome protein 1(ALMS1) ELISA kit
E04A1397-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alstrom syndrome protein 1(ALMS1) ELISA kit
E07A1397-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alstrom syndrome protein 1(ALMS1) ELISA kit
E07A1397-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alstrom syndrome protein 1(ALMS1) ELISA kit
E07A1397-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alstrom syndrome protein 1(ALMS1) ELISA kit
E08A1397-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alstrom syndrome protein 1(ALMS1) ELISA kit
E08A1397-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alstrom syndrome protein 1(ALMS1) ELISA kit
E08A1397-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alstrom syndrome protein 1(ALMS1) ELISA kit
E09A1397-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alstrom syndrome protein 1(ALMS1) ELISA kit
E09A1397-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alstrom syndrome protein 1(ALMS1) ELISA kit
E09A1397-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alstrom syndrome protein 1, ALMS1 ELISA KIT
ELI-11542h	Lifescience Market	96 Tests	EUR 824

Human Hydrolethalus syndrome protein 1, HYLS1 ELISA KIT
ELI-42181h	Lifescience Market	96 Tests	EUR 824

Human Alstrom syndrome protein 1(ALMS1) ELISA kit
CSB-EL001616HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Alstrom syndrome protein 1 (ALMS1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Alstrom syndrome protein 1(ALMS1) ELISA kit
1-CSB-EL001616HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Alstrom syndrome protein 1(ALMS1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Alstrom syndrome protein 1 (ALMS1) ELISA Kit
abx384573-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Alstrom syndrome protein 1 (ALMS1) ELISA Kit
abx388564-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Alms1 ELISA Kit\| Mouse Alstrom syndrome protein 1 ELISA Kit
EF014189	Lifescience Market	96 Tests	EUR 689

Wfs1 ORF Vector (Rat) (pORF)
ORF079137	ABM	1.0 ug DNA	EUR 506

WFS1 Protein Vector (Rat) (pPB-C-His)
PV316546	ABM	500 ng	EUR 1166

WFS1 Protein Vector (Rat) (pPB-N-His)
PV316547	ABM	500 ng	EUR 1166

WFS1 Protein Vector (Rat) (pPM-C-HA)
PV316548	ABM	500 ng	EUR 1166

WFS1 Protein Vector (Rat) (pPM-C-His)
PV316549	ABM	500 ng	EUR 1166

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

Human Fraser Syndrome 1 (FRAS1) ELISA Kit
abx384928-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Fraser Syndrome 1 (FRAS1) ELISA Kit
abx389338-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

WFS1 Chemi-Luminescent ELISA Kit (Human) (OKCD04029)
OKCD04029	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Participates in the regulation of cellular Ca2+ homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca2+ store.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

WFS1 Chemi-Luminescent ELISA Kit (Mouse) (OKCD04030)
OKCD04030	Aviva Systems Biology	96 Wells	EUR 1027
Description: Description of target: Participates in the regulation of cellular Ca2+ homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca2+ store.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Mouse Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E03H0371-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E03H0371-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E03H0371-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alstrom syndrome protein 1(ALMS1) ELISA kit
E05A1397-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alstrom syndrome protein 1(ALMS1) ELISA kit
E05A1397-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alstrom syndrome protein 1(ALMS1) ELISA kit
E05A1397-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Alstrom syndrome protein 1(ALMS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E04H0371-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E04H0371-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E04H0371-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E06H0371-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E06H0371-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E06H0371-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E01H0371-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E01H0371-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E01H0371-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E09H0371-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E09H0371-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E09H0371-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E08H0371-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E08H0371-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E08H0371-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Meckel syndrome type 1 protein, MKS1 ELISA KIT
ELI-15768h	Lifescience Market	96 Tests	EUR 824

Human Hermansky- Pudlak syndrome 1 protein, HPS1 ELISA KIT
ELI-20317h	Lifescience Market	96 Tests	EUR 824

Mouse Hydrolethalus syndrome protein 1 homolog, Hyls1 ELISA KIT
ELI-07934m	Lifescience Market	96 Tests	EUR 865

Pig Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E07H0371-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E07H0371-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Hermansky Pudlak syndrome 1 protein(HPS1) ELISA kit
E07H0371-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hermansky Pudlak syndrome 1 protein(HPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Hyls1 ELISA Kit\| Mouse Hydrolethalus syndrome protein 1 homolog
EF015209	Lifescience Market	96 Tests	EUR 689

HYLS1 ELISA Kit\| Bovine Hydrolethalus syndrome protein 1 homolo
EF011505	Lifescience Market	96 Tests	EUR 689

Human Hydrolethalus Syndrome Protein 1 Homolog (HYLS1) ELISA Kit
abx385018-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Hermansky-Pudlak Syndrome 1 Protein (HPS1) ELISA Kit
abx387875-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Hydrolethalus Syndrome Protein 1 Homolog (HYLS1) ELISA Kit
abx389575-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Alstrom syndrome protein 1 homolog, Alms1 ELISA KIT
ELI-34548m	Lifescience Market	96 Tests	EUR 865

Human Bardet- Biedl syndrome 1 protein, BBS1 ELISA KIT
ELI-34728h	Lifescience Market	96 Tests	EUR 824

Bovine Hydrolethalus syndrome protein 1 homolog, HYLS1 ELISA KIT
ELI-48283b	Lifescience Market	96 Tests	EUR 928

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Rat TIMP-1 AssayMax ELISA Kit
ERT2538-1	AssayPro	96 Well Plate	EUR 477

Rat Hermansky Pudlak syndrome 2 protein(HPS2) ELISA kit
E02H0372-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 2 protein(HPS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 2 protein(HPS2) ELISA kit
E02H0372-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 2 protein(HPS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 2 protein(HPS2) ELISA kit
E02H0372-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 2 protein(HPS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 3 protein(HPS3) ELISA kit
E02H0373-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 3 protein(HPS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 3 protein(HPS3) ELISA kit
E02H0373-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 3 protein(HPS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 3 protein(HPS3) ELISA kit
E02H0373-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 3 protein(HPS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 4 protein(HPS4) ELISA kit
E02H0374-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 4 protein(HPS4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 4 protein(HPS4) ELISA kit
E02H0374-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 4 protein(HPS4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 4 protein(HPS4) ELISA kit
E02H0374-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 4 protein(HPS4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 5 protein(HPS5) ELISA kit
E02H0375-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 5 protein(HPS5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 5 protein(HPS5) ELISA kit
E02H0375-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 5 protein(HPS5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 5 protein(HPS5) ELISA kit
E02H0375-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 5 protein(HPS5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 6 protein(HPS6) ELISA kit
E02H0376-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 6 protein(HPS6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 6 protein(HPS6) ELISA kit
E02H0376-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 6 protein(HPS6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hermansky Pudlak syndrome 6 protein(HPS6) ELISA kit
E02H0376-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Hermansky Pudlak syndrome 6 protein(HPS6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neural Wiskott-Aldrich syndrome protein (WASL) ELISA Kit
abx392121-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

WFS1 Blocking Peptide
DF6566-BP	Affbiotech	1mg	EUR 195

Wolframin (WFS1) Antibody
20-abx008572	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Wolframin (WFS1) Antibody
abx036709-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

WFS1 Blocking Peptide
20-abx063425	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Wolframin (WFS1) Antibody
abx239509-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

WFS1 Conjugated Antibody
C43590	SAB	100ul	EUR 397

WFS1 cloning plasmid
CSB-CL026100HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 2673 Sequence: atggactccaacactgctccgctgggcccctcctgcccacagcccccgccagcaccgcagccccaggcgcgttcccgactcaatgccacagcctcgttggagcaggagaggagcgaaaggccccgagcacccggaccccaggctggccctggccctggtgttagagacgcagcgg Show more
Description: A cloning plasmid for the WFS1 gene.

WFS1 Rabbit pAb
A1705-100ul	Abclonal	100 ul	EUR 308

WFS1 Rabbit pAb
A1705-200ul	Abclonal	200 ul	EUR 459

WFS1 Rabbit pAb
A1705-20ul	Abclonal	20 ul	EUR 183

WFS1 Rabbit pAb
A1705-50ul	Abclonal	50 ul	EUR 223

WFS1 Polyclonal Antibody
ABP60915-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human WFS1 protein Applications tips:
Description: A polyclonal antibody for detection of WFS1 from Human, Mouse. This WFS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WFS1 protein

WFS1 Polyclonal Antibody
ABP60915-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human WFS1 protein Applications tips:
Description: A polyclonal antibody for detection of WFS1 from Human, Mouse. This WFS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WFS1 protein

WFS1 Polyclonal Antibody
ABP60915-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human WFS1 protein Applications tips:
Description: A polyclonal antibody for detection of WFS1 from Human, Mouse. This WFS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WFS1 protein

Rat WFS1(Wolfram Syndrome Protein 1) ELISA Kit