Cattle CSN3(Casein Kappa) ELISA Kit

Cattle CSN3(Casein Kappa) ELISA Kit

To Order Contact us: [email protected]

Cattle Casein Kappa (CSN3) ELISA Kit

SEJ331Bo-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Casein Kappa (CSN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Kappa (CSN3) in milk.

Cattle Casein Kappa (CSN3) ELISA Kit

SEJ331Bo-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Casein Kappa (CSN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Kappa (CSN3) in milk.

Cattle Casein Kappa (CSN3) ELISA Kit

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Casein Kappa elisa. Alternative names of the recognized antigen: CSN10
  • CSNk
  • KCA
  • CASK
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Casein Kappa (CSN3) in samples from milk with no significant corss-reactivity with analogues from other species.

Bovine Casein Kappa (CSN3) ELISA Kit

DLR-CSN3-b-48T 48T
EUR 592
  • Should the Bovine Casein Kappa (CSN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Casein Kappa (CSN3) in samples from milk.

Bovine Casein Kappa (CSN3) ELISA Kit

DLR-CSN3-b-96T 96T
EUR 777
  • Should the Bovine Casein Kappa (CSN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Casein Kappa (CSN3) in samples from milk.

Human Casein Kappa (CSN3) ELISA Kit

DLR-CSN3-Hu-48T 48T
EUR 517
  • Should the Human Casein Kappa (CSN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Casein Kappa (CSN3) in samples from serum, plasma or other biological fluids.

Human Casein Kappa (CSN3) ELISA Kit

DLR-CSN3-Hu-96T 96T
EUR 673
  • Should the Human Casein Kappa (CSN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Casein Kappa (CSN3) in samples from serum, plasma or other biological fluids.

Bovine Casein Kappa (CSN3) ELISA Kit

RDR-CSN3-b-48Tests 48 Tests
EUR 633

Bovine Casein Kappa (CSN3) ELISA Kit

RDR-CSN3-b-96Tests 96 Tests
EUR 884

Human Casein Kappa (CSN3) ELISA Kit

RDR-CSN3-Hu-48Tests 48 Tests
EUR 544

Human Casein Kappa (CSN3) ELISA Kit

RDR-CSN3-Hu-96Tests 96 Tests
EUR 756

Bovine Casein Kappa (CSN3) ELISA Kit

RD-CSN3-b-48Tests 48 Tests
EUR 606

Bovine Casein Kappa (CSN3) ELISA Kit

RD-CSN3-b-96Tests 96 Tests
EUR 844

Human Casein Kappa (CSN3) ELISA Kit

RD-CSN3-Hu-48Tests 48 Tests
EUR 521

Human Casein Kappa (CSN3) ELISA Kit

RD-CSN3-Hu-96Tests 96 Tests
EUR 723

ELISA kit for Cattle CSN3 (Casein Kappa)

ELK8007 1 plate of 96 wells
EUR 526
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Casein Kappa (CSN3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Casein Kappa (
  • Show more
Description: A sandwich ELISA kit for detection of Casein Kappa from Cattle in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Casein Kappa (CSN3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Casein Kappa (CSN3) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1400.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Casein Kappa (CSN3) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Casein Kappa (CSN3) Antibody

  • EUR 982.00
  • EUR 495.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kappa Casein (CSN3) Antibody

abx232019-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Casein Kappa (CSN3)

  • EUR 565.92
  • EUR 254.00
  • EUR 1847.20
  • EUR 682.40
  • EUR 1264.80
  • EUR 442.00
  • EUR 4468.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02668
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 49.0kDa
  • Isoelectric Point: 5.9
Description: Recombinant Bovine Casein Kappa expressed in: E.coli

Recombinant Casein Kappa (CSN3)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07498
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Casein Kappa expressed in: E.coli

Human Casein Kappa (CSN3)ELISA Kit

201-12-2883 96 tests
EUR 440
  • This Casein Kappa ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Bovine CSN3/ Kappa-casein ELISA Kit

E0074Bo 1 Kit
EUR 717

Rat Kappa casein(CSN3) ELISA kit

E02K0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Kappa casein(CSN3) ELISA kit

E02K0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Kappa casein(CSN3) ELISA kit

E02K0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Kappa casein(CSN3) ELISA kit

E04K0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Kappa casein(CSN3) ELISA kit

E04K0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Kappa casein(CSN3) ELISA kit

E04K0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CSN3/ Kappa-casein ELISA Kit

E0577Hu 1 Kit
EUR 605

Rat Csn3/ Kappa-casein ELISA Kit

E0241Ra 1 Kit
EUR 646

Mouse Kappa casein(CSN3) ELISA kit

E03K0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kappa casein(CSN3) ELISA kit

E03K0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kappa casein(CSN3) ELISA kit

E03K0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kappa casein(CSN3) ELISA kit

E01K0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kappa casein(CSN3) ELISA kit

E01K0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kappa casein(CSN3) ELISA kit

E01K0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cow Casein kappa (CSN3) ELISA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Casein kappa (CSN3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Monkey Kappa casein(CSN3) ELISA kit

E09K0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Kappa casein(CSN3) ELISA kit

E09K0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Kappa casein(CSN3) ELISA kit

E09K0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Kappa casein(CSN3) ELISA kit

E06K0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Kappa casein(CSN3) ELISA kit

E06K0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Kappa casein(CSN3) ELISA kit

E06K0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Kappa casein(CSN3) ELISA kit

E08K0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Kappa casein(CSN3) ELISA kit

E08K0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Kappa casein(CSN3) ELISA kit

E08K0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Kappa- casein, CSN3 ELISA KIT

ELI-23848b 96 Tests
EUR 928

Human Kappa- casein, CSN3 ELISA KIT

ELI-23849h 96 Tests
EUR 824

Porcine Kappa- casein, CSN3 ELISA KIT

ELI-23850p 96 Tests
EUR 928

Pig Kappa casein(CSN3) ELISA kit

E07K0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Kappa casein(CSN3) ELISA kit

E07K0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Kappa casein(CSN3) ELISA kit

E07K0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Kappa-casein(CSN3) ELISA kit

CSB-EL006064BO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Bovine Kappa-casein (CSN3) in samples from breastmilk. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Bovine Kappa-casein(CSN3) ELISA kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Bovine Kappa-casein(CSN3) in samples from breastmilk. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Kappa-casein(CSN3) ELISA kit

CSB-EL006064HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Kappa-casein (CSN3) in samples from serum, plasma, tissue homogenates, otherbiologicalfluids. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Kappa-casein(CSN3) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Kappa-casein(CSN3) in samples from serum, plasma, tissue homogenates, otherbiologicalfluids. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cow Kappa Casein (CSN3) ELISA Kit

abx555452-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Pig Kappa Casein (CSN3) ELISA Kit

abx555666-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Rat Kappa Casein (CSN3) ELISA Kit

abx555992-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Kappa Casein (CSN3) ELISA Kit

abx556064-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Kappa Casein (CSN3) ELISA Kit

abx575410-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Rat Kappa- casein, Csn3 ELISA KIT

ELI-33106r 96 Tests
EUR 886

Mouse Kappa- casein, Csn3 ELISA KIT

ELI-34476m 96 Tests
EUR 865

Human Casein Kappa(CSN3)ELISA Kit

QY-E02404 96T
EUR 361

Bovine Casein Kappa ELISA Kit (CSN3)

RK00450 96 Tests
EUR 573

Human Casein Kappa ELISA Kit (CSN3)

RK01196 96 Tests
EUR 521

Human Casein Kappa (CSN3) ELISA Kit

SEJ331Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Casein Kappa (CSN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Casein Kappa (CSN3) in Breast milk and other biological fluids.

Human Casein Kappa (CSN3) ELISA Kit

SEJ331Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Casein Kappa (CSN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Casein Kappa (CSN3) in Breast milk and other biological fluids.

Human Casein Kappa (CSN3) ELISA Kit

SEJ331Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Casein Kappa (CSN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Casein Kappa (CSN3) in Breast milk and other biological fluids.

Human Casein Kappa (CSN3) ELISA Kit

SEJ331Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Casein Kappa (CSN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Casein Kappa (CSN3) in Breast milk and other biological fluids.

Human Casein Kappa (CSN3) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Casein Kappa elisa. Alternative names of the recognized antigen: CSN10
  • CSNk
  • KCA
  • CASK
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Casein Kappa (CSN3) in samples from Breast milk and other biological fluids with no significant corss-reactivity with analogues from other species.

Guinea pig Kappa casein(CSN3) ELISA kit

E05K0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Kappa casein(CSN3) ELISA kit

E05K0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Kappa casein(CSN3) ELISA kit

E05K0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Kappa casein(CSN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human CSN3 (Casein Kappa)

ELK4819 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Casein Kappa (CSN3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Casein Kappa (
  • Show more
Description: A sandwich ELISA kit for detection of Casein Kappa from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Kappa-casein (CSN3)

KTE62271-48T 48T
EUR 332
  • KCA gene extends over 8,821 nucleotides and consists of 5 exons ranging from 33 to 496 nucleotides separated by introns ranging from 1,146 to 2,942 nucleotides. The human and bovine KCA genes are very similar, with a conserved gene organization and o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kappa-casein (CSN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kappa-casein (CSN3)

KTE62271-5platesof96wells 5 plates of 96 wells
EUR 2115
  • KCA gene extends over 8,821 nucleotides and consists of 5 exons ranging from 33 to 496 nucleotides separated by introns ranging from 1,146 to 2,942 nucleotides. The human and bovine KCA genes are very similar, with a conserved gene organization and o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kappa-casein (CSN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kappa-casein (CSN3)

KTE62271-96T 96T
EUR 539
  • KCA gene extends over 8,821 nucleotides and consists of 5 exons ranging from 33 to 496 nucleotides separated by introns ranging from 1,146 to 2,942 nucleotides. The human and bovine KCA genes are very similar, with a conserved gene organization and o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kappa-casein (CSN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Casein Kappa (CSN3) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cow Casein Kappa (CSN3) Protein

  • EUR 787.00
  • EUR 300.00
  • EUR 2486.00
  • EUR 940.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cow Casein kappa (CSN3) CLIA Kit

  • EUR 9242.00
  • EUR 4920.00
  • EUR 1130.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Casein kappa (CSN3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Csn3 ELISA Kit| Rat Kappa-casein ELISA Kit

EF018435 96 Tests
EUR 689

Csn3 ELISA Kit| Mouse Kappa-casein ELISA Kit

EF014412 96 Tests
EUR 689

Casein Kappa (CSN3) Polyclonal Antibody (Bovine)

  • EUR 274.00
  • EUR 2945.00
  • EUR 724.00
  • EUR 349.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln22~Val190
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Casein Kappa (CSN3)

Casein Kappa (CSN3) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CSN3 (Asn24~Thr181)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Casein Kappa (CSN3)

Casein Kappa (CSN3) Polyclonal Antibody (Bovine), APC

  • EUR 386.00
  • EUR 3869.00
  • EUR 1061.00
  • EUR 499.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln22~Val190
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Casein Kappa (CSN3). This antibody is labeled with APC.

Casein Kappa (CSN3) Polyclonal Antibody (Bovine), Biotinylated

  • EUR 342.00
  • EUR 2895.00
  • EUR 836.00
  • EUR 424.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln22~Val190
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Casein Kappa (CSN3). This antibody is labeled with Biotin.

Casein Kappa (CSN3) Polyclonal Antibody (Bovine), Cy3

  • EUR 474.00
  • EUR 5117.00
  • EUR 1373.00
  • EUR 624.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln22~Val190
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Casein Kappa (CSN3). This antibody is labeled with Cy3.

Casein Kappa (CSN3) Polyclonal Antibody (Bovine), FITC

  • EUR 329.00
  • EUR 3115.00
  • EUR 868.00
  • EUR 419.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln22~Val190
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Casein Kappa (CSN3). This antibody is labeled with FITC.

Casein Kappa (CSN3) Polyclonal Antibody (Bovine), HRP

  • EUR 351.00
  • EUR 3369.00
  • EUR 936.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln22~Val190
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Casein Kappa (CSN3). This antibody is labeled with HRP.

Casein Kappa (CSN3) Polyclonal Antibody (Bovine), PE

  • EUR 329.00
  • EUR 3115.00
  • EUR 868.00
  • EUR 419.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln22~Val190
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Casein Kappa (CSN3). This antibody is labeled with PE.

Casein Kappa (CSN3) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CSN3 (Asn24~Thr181)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Casein Kappa (CSN3). This antibody is labeled with APC.

Casein Kappa (CSN3) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CSN3 (Asn24~Thr181)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Casein Kappa (CSN3). This antibody is labeled with Biotin.

Casein Kappa (CSN3) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CSN3 (Asn24~Thr181)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Casein Kappa (CSN3). This antibody is labeled with Cy3.

Casein Kappa (CSN3) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CSN3 (Asn24~Thr181)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Casein Kappa (CSN3). This antibody is labeled with FITC.

Casein Kappa (CSN3) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CSN3 (Asn24~Thr181)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Casein Kappa (CSN3). This antibody is labeled with HRP.

Casein Kappa (CSN3) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CSN3 (Asn24~Thr181)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Casein Kappa (CSN3). This antibody is labeled with PE.

Kappa casein ELISA Kit| Bovine Kappa casein ELISA Kit

EF011008 96 Tests
EUR 689

Casein Kappa (CSN3) Polyclonal Antibody (Bovine), APC-Cy7

  • EUR 653.00
  • EUR 7618.00
  • EUR 2002.00
  • EUR 878.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln22~Val190
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Casein Kappa (CSN3). This antibody is labeled with APC-Cy7.

Casein Kappa (CSN3) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CSN3 (Asn24~Thr181)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Casein Kappa (CSN3). This antibody is labeled with APC-Cy7.

Cattle Casein Beta (CSN2) ELISA Kit

SEJ332Bo-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Casein Beta (CSN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Beta (CSN2) in milk.

Cattle Casein Beta (CSN2) ELISA Kit

SEJ332Bo-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Casein Beta (CSN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Beta (CSN2) in milk.

Cattle Casein Beta (CSN2) ELISA Kit

SEJ332Bo-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Casein Beta (CSN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Beta (CSN2) in milk.

Cattle Casein Beta (CSN2) ELISA Kit

SEJ332Bo-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Casein Beta (CSN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Beta (CSN2) in milk.

Cattle Casein Beta (CSN2) ELISA Kit

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Casein Beta elisa. Alternative names of the recognized antigen: CASb
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Casein Beta (CSN2) in samples from milk with no significant corss-reactivity with analogues from other species.

Cattle Casein Alpha (CSN1) ELISA Kit

SEJ333Bo-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Casein Alpha (CSN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Alpha (CSN1) in milk.

Cattle Casein Alpha (CSN1) ELISA Kit

SEJ333Bo-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Casein Alpha (CSN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Alpha (CSN1) in milk.

Cattle Casein Alpha (CSN1) ELISA Kit

SEJ333Bo-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Casein Alpha (CSN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Alpha (CSN1) in milk.

Cattle Casein Alpha (CSN1) ELISA Kit

SEJ333Bo-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Casein Alpha (CSN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Alpha (CSN1) in milk.

Cattle Casein Alpha (CSN1) ELISA Kit

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Casein Alpha elisa. Alternative names of the recognized antigen: CASa
  • CSN1
  • CSN1S1
  • Casein Alpha S1
  • Caseinate
  • Caseine/caséine/Kasein/caseína
  • Alpha-S1-casein
  • Casoxin-D
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Casein Alpha (CSN1) in samples from milk with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat Kappa-casein

EK3314 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Kappa-casein in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Bovine Kappa-casein

EK3315 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Kappa-casein in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Cattle CSN2 (Casein Beta)

ELK7989 1 plate of 96 wells
EUR 526
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Casein Beta (CSN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Casein Beta (CS
  • Show more
Description: A sandwich ELISA kit for detection of Casein Beta from Cattle in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Cattle CSN1 (Casein Alpha)

ELK8008 1 plate of 96 wells
EUR 526
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Casein Alpha (CSN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Casein Alpha (
  • Show more
Description: A sandwich ELISA kit for detection of Casein Alpha from Cattle in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

High Sensitive Cattle Casein Alpha (CSN1) ELISA Kit

HEJ333Bo-10x96wellstestplate 10x96-wells test plate
EUR 6197.58
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Cattle Casein Alpha (CSN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Alpha (CSN1) in milk.

High Sensitive Cattle Casein Alpha (CSN1) ELISA Kit

HEJ333Bo-1x48wellstestplate 1x48-wells test plate
EUR 598.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Cattle Casein Alpha (CSN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Alpha (CSN1) in milk.

High Sensitive Cattle Casein Alpha (CSN1) ELISA Kit

HEJ333Bo-1x96wellstestplate 1x96-wells test plate
EUR 811.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Cattle Casein Alpha (CSN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Alpha (CSN1) in milk.

High Sensitive Cattle Casein Alpha (CSN1) ELISA Kit

HEJ333Bo-5x96wellstestplate 5x96-wells test plate
EUR 3351.66
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Cattle Casein Alpha (CSN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Casein Alpha (CSN1) in milk.

High Sensitive Cattle Casein Alpha (CSN1) ELISA Kit

  • EUR 6248.00
  • EUR 3302.00
  • EUR 812.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Casein Alpha elisa. Alternative names of the recognized antigen: CASa
  • CSN1
  • CSN1S1
  • Casein Alpha S1
  • Caseinate
  • Caseine/caséine/Kasein/caseína
  • Alpha-S1-casein
  • Casoxin-D
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Cattle Casein Alpha (CSN1) in samples from milk with no significant corss-reactivity with analogues from other species.

Recombinant Human κ-Casein/CSN3(C-6His)

CA40-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mMPB,150mMNaCl,pH7.4.

Recombinant Human κ-Casein/CSN3(C-6His)

CA40-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of 20mMPB,150mMNaCl,pH7.4.

Recombinant Human κ-Casein/CSN3(C-6His)

CA40-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mMPB,150mMNaCl,pH7.4.

Recombinant Human κ-Casein/CSN3(C-6His)

CA40-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mMPB,150mMNaCl,pH7.4.


EF008875 96 Tests
EUR 689

CSN3 ELISA Kit (Human) (OKCD01122)

OKCD01122 96 Wells
EUR 831
Description: Description of target: Kappa-casein stabilizes micelle formation, preventing casein precipitation in milk. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.31 ng/mL

CSN3 ELISA Kit (Bovine) (OKCD01994)

OKCD01994 96 Wells
EUR 975
Description: Description of target: Kappa-casein stabilizes micelle formation, preventing casein precipitation in milk. Casoxins A, B and C have opioid antagonist activity. Casoxin C causes biphasic ileal contractions through the binding to the complement C3a receptors. Casoplatelin inhibits platelet aggregation. ;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 13.3 ng/mL

CSN3 ELISA Kit (Rat) (OKEH06479)

OKEH06479 96 Wells
EUR 662
Description: Description of target: Kappa-casein stabilizes micelle formation, preventing casein precipitation in milk. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.18 ng/mL

CSN3 ELISA Kit (Bovine) (OKEH07974)

OKEH07974 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.3ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

CSN3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSN3. Recognizes CSN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

CSN3 antibody

70R-9142 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CSN3 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11146 50 ug
EUR 363
Description: Mouse polyclonal to CSN3


YF-PA11147 100 ug
EUR 403
Description: Rabbit polyclonal to CSN3

Human Casein ELISA kit

E01C0905-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Casein ELISA kit

E01C0905-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Casein ELISA kit

E01C0905-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Casein ELISA kit

E06C0905-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Casein ELISA kit

E06C0905-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Casein ELISA kit

E06C0905-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Casein ELISA kit

E03C0905-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Casein ELISA kit

E03C0905-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Casein ELISA kit

E03C0905-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Casein ELISA kit

E04C0905-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Casein ELISA kit

E04C0905-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Casein ELISA kit

E04C0905-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Casein ELISA kit

E02C0905-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Casein ELISA kit

E02C0905-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Casein ELISA kit

E02C0905-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Casein ELISA kit

E09C0905-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Casein ELISA kit

E09C0905-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Casein ELISA kit

E09C0905-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Casein ELISA kit

E08C0905-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Casein ELISA kit

E08C0905-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Casein ELISA kit

E08C0905-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Casein ELISA kit

E07C0905-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Casein ELISA kit

E07C0905-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Casein ELISA kit

E07C0905-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Casein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CSN3 Blocking Peptide

33R-6168 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CSN3 antibody, catalog no. 70R-9142

CSN3 cloning plasmid

CSB-CL006064HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 549
  • Sequence: atgaaaagttttcttctagttgtcaatgccctggcattaaccctgccttttttggctgtggaggttcaaaaccagaaacaaccagcatgccatgagaatgatgaaagaccattctatcagaaaacagctccatatgtcccaatgtattatgtgccaaatagctatccttattatgg
  • Show more
Description: A cloning plasmid for the CSN3 gene.

CSN3 Polyclonal Antibody

ABP51060-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CSN3 at AA range: 340-420
  • Applications tips:
Description: A polyclonal antibody for detection of CSN3 from Human, Mouse, Rat. This CSN3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CSN3 at AA range: 340-420

CSN3 Polyclonal Antibody

ABP51060-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CSN3 at AA range: 340-420
  • Applications tips:
Description: A polyclonal antibody for detection of CSN3 from Human, Mouse, Rat. This CSN3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CSN3 at AA range: 340-420

CSN3 Polyclonal Antibody

ABP51060-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CSN3 at AA range: 340-420
  • Applications tips:
Description: A polyclonal antibody for detection of CSN3 from Human, Mouse, Rat. This CSN3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CSN3 at AA range: 340-420

CSN3 Polyclonal Antibody

ES2059-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CSN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

CSN3 Polyclonal Antibody

ES2059-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CSN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti- CSN3 antibody

FNab02019 100µg
EUR 505.25
  • Immunogen: casein kappa
  • Uniprot ID: P07498
  • Gene ID: 1448
  • Research Area: Metabolism
Description: Antibody raised against CSN3

Anti-CSN3 antibody

PAab02019 100 ug
EUR 355

Anti-CSN3 antibody

STJ92499 200 µl
EUR 197
Description: Rabbit polyclonal to CSN3.

Human Kappa ELISA Kit

E-80KPA 1 x 96 well plate
EUR 441

Cattle Prolactin (PRL) ELISA Kit

CEA846Bo-10x96wellstestplate 10x96-wells test plate
EUR 5320.55
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Prolactin (PRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Prolactin (PRL) in serum, plasma and other biological fluids.

Cattle Prolactin (PRL) ELISA Kit

CEA846Bo-1x48wellstestplate 1x48-wells test plate
EUR 525.81
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Prolactin (PRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Prolactin (PRL) in serum, plasma and other biological fluids.

Cattle Prolactin (PRL) ELISA Kit

CEA846Bo-1x96wellstestplate 1x96-wells test plate
EUR 708.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Prolactin (PRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Prolactin (PRL) in serum, plasma and other biological fluids.

Cattle Prolactin (PRL) ELISA Kit

CEA846Bo-5x96wellstestplate 5x96-wells test plate
EUR 2887.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Prolactin (PRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Prolactin (PRL) in serum, plasma and other biological fluids.

Cattle Prolactin (PRL) ELISA Kit

  • EUR 5371.00
  • EUR 2838.00
  • EUR 709.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prolactin elisa. Alternative names of the recognized antigen: LTH
  • Luteotropic Hormone
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Cattle Prolactin (PRL) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Aprotinin (AP) ELISA Kit

CEA968Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Aprotinin (AP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Aprotinin (AP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Aprotinin (AP) ELISA Kit

CEA968Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Aprotinin (AP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Aprotinin (AP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Aprotinin (AP) ELISA Kit

CEA968Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Aprotinin (AP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Aprotinin (AP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Aprotinin (AP) ELISA Kit

CEA968Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Aprotinin (AP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Aprotinin (AP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Aprotinin (AP) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Aprotinin elisa. Alternative names of the recognized antigen: BPTI
  • Trasylol
  • Pancreatic Trypsin Inhibitor
  • Basic protease inhibitor
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Cattle Aprotinin (AP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Ghrelin (GHRL) ELISA Kit

CEA991Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Ghrelin (GHRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Ghrelin (GHRL) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Ghrelin (GHRL) ELISA Kit

CEA991Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Ghrelin (GHRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Ghrelin (GHRL) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Ghrelin (GHRL) ELISA Kit

CEA991Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Ghrelin (GHRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Ghrelin (GHRL) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Ghrelin (GHRL) ELISA Kit

CEA991Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Ghrelin (GHRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Ghrelin (GHRL) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Ghrelin (GHRL) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ghrelin elisa. Alternative names of the recognized antigen: MTLRP
  • Growth Hormone-Releasing Peptide
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Cattle Ghrelin (GHRL) in samples from serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Relaxin (RLN) ELISA Kit

CEB216Bo-10x96wellstestplate 10x96-wells test plate
EUR 5372.91
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Relaxin (RLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Relaxin (RLN) in serum, plasma and other biological fluids.

Cattle Relaxin (RLN) ELISA Kit

CEB216Bo-1x48wellstestplate 1x48-wells test plate
EUR 530.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Relaxin (RLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Relaxin (RLN) in serum, plasma and other biological fluids.

Cattle Relaxin (RLN) ELISA Kit

CEB216Bo-1x96wellstestplate 1x96-wells test plate
EUR 714.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Relaxin (RLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Relaxin (RLN) in serum, plasma and other biological fluids.

Cattle Relaxin (RLN) ELISA Kit

CEB216Bo-5x96wellstestplate 5x96-wells test plate
EUR 2915.07
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Relaxin (RLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Relaxin (RLN) in serum, plasma and other biological fluids.

Cattle Relaxin (RLN) ELISA Kit

  • EUR 5423.00
  • EUR 2866.00
  • EUR 715.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Relaxin elisa. Alternative names of the recognized antigen: RLXH1
  • Relaxin H1
  • Prorelaxin H1
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Cattle Relaxin (RLN) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Hemoglobin (HB) ELISA Kit

CEB409Bo-10x96wellstestplate 10x96-wells test plate
EUR 5372.91
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Hemoglobin (HB) in serum, plasma, erythrocyte lysates and other biological fluids.

Cattle Hemoglobin (HB) ELISA Kit

CEB409Bo-1x48wellstestplate 1x48-wells test plate
EUR 530.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Hemoglobin (HB) in serum, plasma, erythrocyte lysates and other biological fluids.

Cattle Hemoglobin (HB) ELISA Kit

CEB409Bo-1x96wellstestplate 1x96-wells test plate
EUR 714.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Hemoglobin (HB) in serum, plasma, erythrocyte lysates and other biological fluids.

Cattle Hemoglobin (HB) ELISA Kit

CEB409Bo-5x96wellstestplate 5x96-wells test plate
EUR 2915.07
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Hemoglobin (HB) in serum, plasma, erythrocyte lysates and other biological fluids.

Cattle Hemoglobin (HB) ELISA Kit

  • EUR 5423.00
  • EUR 2866.00
  • EUR 715.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hemoglobin elisa. Alternative names of the recognized antigen: Hgb
  • Haemoglobin
  • Heterotetramer(αβ)2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Cattle Hemoglobin (HB) in samples from Serum, plasma, erythrocyte lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Insulin (INS) ELISA Kit

CEA448Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Insulin (INS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Insulin (INS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Insulin (INS) ELISA Kit

CEA448Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Insulin (INS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Insulin (INS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Insulin (INS) ELISA Kit

CEA448Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Insulin (INS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Insulin (INS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Insulin (INS) ELISA Kit

CEA448Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Insulin (INS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Insulin (INS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Insulin (INS) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Insulin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Cattle Insulin (INS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Cholecystokinin (CCK) ELISA Kit

CEA802Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Cholecystokinin (CCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Cholecystokinin (CCK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Cholecystokinin (CCK) ELISA Kit

CEA802Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Cholecystokinin (CCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Cholecystokinin (CCK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Cholecystokinin (CCK) ELISA Kit

CEA802Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Cholecystokinin (CCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Cholecystokinin (CCK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Cholecystokinin (CCK) ELISA Kit

CEA802Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Cholecystokinin (CCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Cattle Cholecystokinin (CCK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Cholecystokinin (CCK) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cholecystokinin elisa. Alternative names of the recognized antigen: CCK-PZ
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Cattle Cholecystokinin (CCK) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Amphiregulin (AREG) ELISA Kit

SEA006Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Amphiregulin (AREG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Amphiregulin (AREG) in serum, plasma and other biological fluids..

Cattle Amphiregulin (AREG) ELISA Kit

SEA006Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Amphiregulin (AREG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Amphiregulin (AREG) in serum, plasma and other biological fluids..

Cattle Amphiregulin (AREG) ELISA Kit

SEA006Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Amphiregulin (AREG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Amphiregulin (AREG) in serum, plasma and other biological fluids..

Cattle Amphiregulin (AREG) ELISA Kit

SEA006Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Amphiregulin (AREG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Amphiregulin (AREG) in serum, plasma and other biological fluids..

Cattle Amphiregulin (AREG) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Amphiregulin elisa. Alternative names of the recognized antigen: AR
  • SDGF
  • Colorectum Cell-Derived Growth Factor
  • Schwannoma-Derived Growth Factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Amphiregulin (AREG) in samples from Serum, plasma and other biological fluids.. with no significant corss-reactivity with analogues from other species.

Cattle Angiogenin (ANG) ELISA Kit

SEA007Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Angiogenin (ANG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Angiogenin (ANG) in serum, plasma and other biological fluids.

Cattle Angiogenin (ANG) ELISA Kit

SEA007Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Angiogenin (ANG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Angiogenin (ANG) in serum, plasma and other biological fluids.

Cattle Angiogenin (ANG) ELISA Kit

SEA007Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Angiogenin (ANG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Angiogenin (ANG) in serum, plasma and other biological fluids.

Cattle Angiogenin (ANG) ELISA Kit

SEA007Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Angiogenin (ANG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Angiogenin (ANG) in serum, plasma and other biological fluids.

Cattle Angiogenin (ANG) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Angiogenin elisa. Alternative names of the recognized antigen: RNASE5
  • Ribonuclease, RNase A Family 5
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Angiogenin (ANG) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Cattle Fibronectin (FN) ELISA Kit

SEA037Bo-10x96wellstestplate 10x96-wells test plate
EUR 3095.25
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Fibronectin (FN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Fibronectin (FN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Fibronectin (FN) ELISA Kit

SEA037Bo-1x48wellstestplate 1x48-wells test plate
EUR 342.55
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Fibronectin (FN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Fibronectin (FN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Fibronectin (FN) ELISA Kit

SEA037Bo-1x96wellstestplate 1x96-wells test plate
EUR 446.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Fibronectin (FN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Fibronectin (FN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Fibronectin (FN) ELISA Kit

SEA037Bo-5x96wellstestplate 5x96-wells test plate
EUR 1709.25
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Fibronectin (FN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Fibronectin (FN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Fibronectin (FN) ELISA Kit

  • EUR 3146.00
  • EUR 1660.00
  • EUR 447.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fibronectin elisa. Alternative names of the recognized antigen: FN1
  • CIG
  • FINC
  • LETS
  • MSF
  • GFND2
  • Anastellin
  • Migration-Stimulating Factor
  • Cold-Insoluble Globulin
  • Large, External, Transformation-Sensitive Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Fibronectin (FN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Hepcidin (Hepc) ELISA Kit

SEB979Bo-10x96wellstestplate 10x96-wells test plate
EUR 5372.91
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hepcidin (Hepc) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Hepcidin (Hepc) in serum, plasma and other biological fluids.

Cattle Hepcidin (Hepc) ELISA Kit

SEB979Bo-1x48wellstestplate 1x48-wells test plate
EUR 530.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hepcidin (Hepc) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Hepcidin (Hepc) in serum, plasma and other biological fluids.

Cattle Hepcidin (Hepc) ELISA Kit

SEB979Bo-1x96wellstestplate 1x96-wells test plate
EUR 714.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hepcidin (Hepc) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Hepcidin (Hepc) in serum, plasma and other biological fluids.

Cattle Hepcidin (Hepc) ELISA Kit

SEB979Bo-5x96wellstestplate 5x96-wells test plate
EUR 2915.07
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hepcidin (Hepc) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Hepcidin (Hepc) in serum, plasma and other biological fluids.

Cattle Hepcidin (Hepc) ELISA Kit

  • EUR 5423.00
  • EUR 2866.00
  • EUR 715.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hepcidin elisa. Alternative names of the recognized antigen: HAMP
  • HFE2B
  • PLTR
  • LEAP1
  • Hepcidin Antimicrobial Peptide
  • Liver-expressed antimicrobial peptide 1
  • Putative liver tumor regressor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Hepcidin (Hepc) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Cattle Myeloperoxidase (MPO) ELISA Kit

SEA601Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Myeloperoxidase (MPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Myeloperoxidase (MPO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Cattle Myeloperoxidase (MPO) ELISA Kit

SEA601Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Myeloperoxidase (MPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Myeloperoxidase (MPO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Cattle Myeloperoxidase (MPO) ELISA Kit

SEA601Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Myeloperoxidase (MPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Myeloperoxidase (MPO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Cattle Myeloperoxidase (MPO) ELISA Kit

SEA601Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Myeloperoxidase (MPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Myeloperoxidase (MPO) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Cattle Myeloperoxidase (MPO) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Myeloperoxidase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Myeloperoxidase (MPO) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Adiponectin (ADP) ELISA Kit

SEA605Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Adiponectin (ADP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Adiponectin (ADP) in serum, plasma and other biological fluids.

Cattle Adiponectin (ADP) ELISA Kit

SEA605Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Adiponectin (ADP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Adiponectin (ADP) in serum, plasma and other biological fluids.

Cattle Adiponectin (ADP) ELISA Kit

SEA605Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Adiponectin (ADP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Adiponectin (ADP) in serum, plasma and other biological fluids.

Cattle Adiponectin (ADP) ELISA Kit

SEA605Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Adiponectin (ADP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Adiponectin (ADP) in serum, plasma and other biological fluids.

Cattle Adiponectin (ADP) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adiponectin elisa. Alternative names of the recognized antigen: GBP28
  • ApM1
  • AdipoQ
  • Acrp30
  • ACDC
  • APM1
  • C1Q And Collagen Domain Containing
  • Adipocyte Complement-Related Protein Of 30 KDa
  • Adipose Most Abundant Gene Transcript 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Adiponectin (ADP) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Visfatin (VF) ELISA Kit

SEA638Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Visfatin (VF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Visfatin (VF) in serum, plasma and other biological fluids.

Cattle Visfatin (VF) ELISA Kit

SEA638Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Visfatin (VF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Visfatin (VF) in serum, plasma and other biological fluids.

Cattle Visfatin (VF) ELISA Kit

SEA638Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Visfatin (VF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Visfatin (VF) in serum, plasma and other biological fluids.

Cattle Visfatin (VF) ELISA Kit

SEA638Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Visfatin (VF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Visfatin (VF) in serum, plasma and other biological fluids.

Cattle Visfatin (VF) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Visfatin elisa. Alternative names of the recognized antigen: Nampt
  • NAmPRTase
  • PBEF
  • PBEF1
  • Pre-B-Cell Colony Enhancing Factor
  • Nicotinamide Phosphoribosyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Visfatin (VF) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Cattle Plasminogen (Plg) ELISA Kit

SEB236Bo-10x96wellstestplate 10x96-wells test plate
EUR 5372.91
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Plasminogen (Plg) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Plasminogen (Plg) in serum, plasma and other biological fluids.

Cattle Plasminogen (Plg) ELISA Kit

SEB236Bo-1x48wellstestplate 1x48-wells test plate
EUR 530.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Plasminogen (Plg) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Plasminogen (Plg) in serum, plasma and other biological fluids.

Cattle Plasminogen (Plg) ELISA Kit

SEB236Bo-1x96wellstestplate 1x96-wells test plate
EUR 714.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Plasminogen (Plg) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Plasminogen (Plg) in serum, plasma and other biological fluids.

Cattle Plasminogen (Plg) ELISA Kit

SEB236Bo-5x96wellstestplate 5x96-wells test plate
EUR 2915.07
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Plasminogen (Plg) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Plasminogen (Plg) in serum, plasma and other biological fluids.

Cattle Plasminogen (Plg) ELISA Kit

  • EUR 5423.00
  • EUR 2866.00
  • EUR 715.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Plasminogen elisa. Alternative names of the recognized antigen: PL
  • Plasmin
  • Activation peptide
  • Angiostatin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Plasminogen (Plg) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Pleiotrophin (PTN) ELISA Kit

SEB309Bo-10x96wellstestplate 10x96-wells test plate
EUR 5372.91
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Pleiotrophin (PTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Pleiotrophin (PTN) in serum, plasma and other biological fluids.

Cattle Pleiotrophin (PTN) ELISA Kit

SEB309Bo-1x48wellstestplate 1x48-wells test plate
EUR 530.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Pleiotrophin (PTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Pleiotrophin (PTN) in serum, plasma and other biological fluids.

Cattle Pleiotrophin (PTN) ELISA Kit

SEB309Bo-1x96wellstestplate 1x96-wells test plate
EUR 714.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Pleiotrophin (PTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Pleiotrophin (PTN) in serum, plasma and other biological fluids.

Cattle Pleiotrophin (PTN) ELISA Kit

SEB309Bo-5x96wellstestplate 5x96-wells test plate
EUR 2915.07
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Pleiotrophin (PTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Pleiotrophin (PTN) in serum, plasma and other biological fluids.

Cattle Pleiotrophin (PTN) ELISA Kit

  • EUR 5423.00
  • EUR 2866.00
  • EUR 715.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Pleiotrophin elisa. Alternative names of the recognized antigen: HARP
  • HBGF8
  • HBNF
  • NEGF1
  • Heparin Binding Growth Factor 8
  • Neurite Growth-Promoting Factor 1
  • Heparin Affin Regulatory Peptide
  • Heparin Binding Growth Associated Molecule
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Pleiotrophin (PTN) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Cattle Lactoferrin (LTF) ELISA Kit

SEA780Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Lactoferrin (LTF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Lactoferrin (LTF) in serum, plasma, tissue homogenates, cell lysates, saliva, milk,cell culture supernates and other biological fluids.

Cattle Lactoferrin (LTF) ELISA Kit

SEA780Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Lactoferrin (LTF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Lactoferrin (LTF) in serum, plasma, tissue homogenates, cell lysates, saliva, milk,cell culture supernates and other biological fluids.

Cattle Lactoferrin (LTF) ELISA Kit

SEA780Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Lactoferrin (LTF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Lactoferrin (LTF) in serum, plasma, tissue homogenates, cell lysates, saliva, milk,cell culture supernates and other biological fluids.

Cattle Lactoferrin (LTF) ELISA Kit

SEA780Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Lactoferrin (LTF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Lactoferrin (LTF) in serum, plasma, tissue homogenates, cell lysates, saliva, milk,cell culture supernates and other biological fluids.

Cattle Lactoferrin (LTF) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lactoferrin elisa. Alternative names of the recognized antigen: HLF2
  • LF
  • GIG12
  • Lactotransferrin
  • Growth-inhibiting protein 12
  • Talalactoferrin
  • Lfcin-H
  • Kaliocin-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Lactoferrin (LTF) in samples from serum, plasma, tissue homogenates, cell lysates, saliva, milk, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Haptoglobin (Hpt) ELISA Kit

SEA817Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Haptoglobin (Hpt) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Haptoglobin (Hpt) in serum, plasma and other biological fluids.

Cattle Haptoglobin (Hpt) ELISA Kit

SEA817Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Haptoglobin (Hpt) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Haptoglobin (Hpt) in serum, plasma and other biological fluids.

Cattle Haptoglobin (Hpt) ELISA Kit

SEA817Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Haptoglobin (Hpt) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Haptoglobin (Hpt) in serum, plasma and other biological fluids.

Cattle Haptoglobin (Hpt) ELISA Kit

SEA817Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Haptoglobin (Hpt) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Haptoglobin (Hpt) in serum, plasma and other biological fluids.

Cattle Haptoglobin (Hpt) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Haptoglobin elisa. Alternative names of the recognized antigen: HP
  • Hp2-Alpha
  • Alpha-2-Macroglobulin
  • Zonulin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Haptoglobin (Hpt) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Cattle Prolactin (PRL) ELISA Kit

SEA846Bo-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Prolactin (PRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Prolactin (PRL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Prolactin (PRL) ELISA Kit

SEA846Bo-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Prolactin (PRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Prolactin (PRL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Prolactin (PRL) ELISA Kit

SEA846Bo-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Prolactin (PRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Prolactin (PRL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Prolactin (PRL) ELISA Kit

SEA846Bo-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Prolactin (PRL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Prolactin (PRL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Cattle Prolactin (PRL) ELISA Kit

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prolactin elisa. Alternative names of the recognized antigen: LTH
  • Luteotropic Hormone
Description: Enzyme-linked immunosorbent assay based on the Double-antibody