General Lum(Lumisterol) ELISA Kit

General Lum(Lumisterol) ELISA Kit

To Order Contact us: [email protected]

General Lumisterol (Lum) ELISA Kit
CES509Ge-5x96wellstestplate 5x96-wells test plate
EUR 3261.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Lumisterol (Lum) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Lumisterol (Lum) in serum, plasma and other biological fluids.
General Lumisterol (Lum) ELISA Kit
4-CES509Ge
  • EUR 6078.00
  • EUR 3212.00
  • EUR 792.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lumisterol elisa. Alternative names of the recognized antigen: VD
  • VD1
  • Lamisterol
  • Vitamin D
  • Vitamin D1
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Lumisterol (Lum) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for General Lum (Lumisterol)
ELK7984 1 plate of 96 wells
EUR 372
  • A monoclonal antibody specific to Lumisterol (Lum) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Lumisterol (Lum) and unlabeled Lumisterol (Lum) (Standards or samples) with the pre-coated
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Lumisterol from General in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Lumican (LUM) ELISA Kit
DLR-LUM-Hu-48T 48T
EUR 498
  • Should the Human Lumican (LUM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lumican (LUM) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Lumican (LUM) ELISA Kit
DLR-LUM-Hu-96T 96T
EUR 647
  • Should the Human Lumican (LUM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lumican (LUM) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Lumican (LUM) ELISA Kit
RDR-LUM-Hu-48Tests 48 Tests
EUR 522
Human Lumican (LUM) ELISA Kit
RDR-LUM-Hu-96Tests 96 Tests
EUR 724
Human Lumican (LUM) ELISA Kit
RD-LUM-Hu-48Tests 48 Tests
EUR 500
Human Lumican (LUM) ELISA Kit
RD-LUM-Hu-96Tests 96 Tests
EUR 692
Lumisterol ELISA Kit (OKCD02278)
OKCD02278 96 Wells
EUR 1027
Description: Description of target: Lumisterol is a steroid of interest both because its biosynthesis in FUNGI is a target of ANTIFUNGAL AGENTS, notably AZOLES, and because when it is present in SKIN of animals, ULTRAVIOLET RAYS break a bond to result in ERGOCALCIFEROL.;Species reactivity: Pan-Species;Application: ;Assay info: Assay Methodology: Competitive Inhibition Immunoassay;Sensitivity: 2.19 ng/mL
Vitamin D (Lumisterol) ELISA Kit
20-abx150388
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Lum/ Rat Lum ELISA Kit
ELI-04935r 96 Tests
EUR 886
Vitamin D (Lumisterol) CLIA Kit
20-abx490551
  • EUR 9242.00
  • EUR 4920.00
  • EUR 1130.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human LUM ELISA Kit
ELA-E1496h 96 Tests
EUR 824
LUM ELISA KIT|Human
EF000178 96 Tests
EUR 689
Human lumican,LUM ELISA Kit
201-12-1872 96 tests
EUR 440
  • This lumican ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Mouse Lumican(LUM) ELISA kit
CSB-EL013234MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lumican (LUM) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Lumican(LUM) ELISA kit
1-CSB-EL013234MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lumican(LUM) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Lumican(LUM) ELISA kit
CSB-EL013234RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Lumican (LUM) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rat Lumican(LUM) ELISA kit
1-CSB-EL013234RA
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Lumican(LUM) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Lum/ Lumican ELISA Kit
E0582Ra 1 Kit
EUR 571
Human Lumican (LUM) ELISA Kit
20-abx152244
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Lumican (Lum) ELISA Kit
abx255626-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Lumican (LUM) ELISA Kit
abx251541-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Lum/ Lumican ELISA Kit
E0904Mo 1 Kit
EUR 571
Human LUM/ Lumican ELISA Kit
E1518Hu 1 Kit
EUR 571
Human LUM(Lumican) ELISA Kit
EH0220 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P51884
  • Alias: Lumican/LUM/LDC/SLRR2D
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Bovine Lumican, LUM ELISA KIT
ELI-04933b 96 Tests
EUR 928
Mouse Lumican, Lum ELISA KIT
ELI-04934m 96 Tests
EUR 865
Rabbit Lumican, LUM ELISA KIT
ELI-04936Ra 96 Tests
EUR 928
Chicken Lumican, LUM ELISA KIT
ELI-04937c 96 Tests
EUR 928
Human Lumican, LUM ELISA KIT
ELI-04938h 96 Tests
EUR 824
Human lumican, LUM ELISA Kit
CSB-E09797h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human lumican, LUM in samples from serum, urine, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human lumican, LUM ELISA Kit
1-CSB-E09797h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human lumican, LUM in samples from serum, urine, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Lumican (LUM) ELISA Kit
abx350774-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Chicken Lumican (LUM) ELISA Kit
abx354656-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Lumican (LUM) ELISA Kit
abx354948-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Lumican (LUM) ELISA Kit
abx355098-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Lumican (LUM) ELISA Kit
abx355262-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Lumican (LUM) ELISA Kit
abx573449-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Cow Lumican (LUM) ELISA Kit
abx517282-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Chicken Lumican (LUM) ELISA Kit
abx517283-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Lumican (LUM) ELISA Kit
abx517285-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Rat Lum(Lumican) ELISA Kit
ER0046 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P51886
  • Alias: Lumican/LUM/LDC/SLRR2D/Keratan sulfate proteoglycan lumican/KSPG lumican
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml
Human lumican(LUM)ELISA Kit
GA-E1888HM-48T 48T
EUR 289
Human lumican(LUM)ELISA Kit
GA-E1888HM-96T 96T
EUR 466
Human lumican(LUM)ELISA Kit
QY-E03003 96T
EUR 361
Human Lumican (LUM) ELISA Kit
SEB496Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Lumican (LUM) ELISA Kit
SEB496Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Lumican (LUM) ELISA Kit
SEB496Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Lumican (LUM) ELISA Kit
SEB496Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Lumican (LUM) ELISA Kit
4-SEB496Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lumican elisa. Alternative names of the recognized antigen: LDC
  • SLRR2D
  • KSPG lumican
  • Keratan sulfate proteoglycan lumican
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lumican (LUM) in samples from Tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
LUM ELISA Kit (Rat) (OKCA01900)
OKCA01900 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL
LUM ELISA Kit (Human) (OKCD07441)
OKCD07441 96 Wells
EUR 936
Description: Description of target: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.124ng/mL
LUM ELISA Kit (Mouse) (OKEH07051)
OKEH07051 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.176 ng/mL
Lum ELISA Kit (Rat) (OKEH04582)
OKEH04582 96 Wells
EUR 662
Description: Description of target: Member of leucine-rich proteoglycan family; may play a role in immature and transient fibrosis of acute pancreatitis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.316 ng/mL
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Lum ELISA Kit| Rat Lumican ELISA Kit
EF017042 96 Tests
EUR 689
ELISA kit for Human LUM (Lumican)
E-EL-H0198 1 plate of 96 wells
EUR 534
  • Gentaur's LUM ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human LUM. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human LUM (Lumican) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Mouse LUM (Lumican)
E-EL-M1309 1 plate of 96 wells
EUR 534
  • Gentaur's LUM ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse LUM. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse LUM (Lumican) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human LUM (Lumican)
ELK2021 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lumican (LUM). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lumican (LUM). Next,
  • Show more
Description: A sandwich ELISA kit for detection of Lumican from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Guinea pig Lumican (LUM) ELISA Kit
abx354788-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
ELISA kit for Human Lumican (LUM)
KTE62236-48T 48T
EUR 354
  • Lumican is a member of the small leucine-rich proteoglycan family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. The protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lumican (LUM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Lumican (LUM)
KTE62236-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Lumican is a member of the small leucine-rich proteoglycan family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. The protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lumican (LUM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Lumican (LUM)
KTE62236-96T 96T
EUR 572
  • Lumican is a member of the small leucine-rich proteoglycan family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. The protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lumican (LUM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
LUM antibody
70R-18332 50 ul
EUR 435
Description: Rabbit polyclonal LUM antibody
LUM Antibody
36591-100ul 100ul
EUR 252
LUM Antibody
1-CSB-PA781691
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
LUM Antibody
1-CSB-PA788951
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
LUM Antibody
DF7293 200ul
EUR 304
Description: LUM Antibody detects endogenous levels of total LUM.
LUM antibody
70R-9283 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LUM antibody
LUM Antibody
1-CSB-PA013234ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LUM. Recognizes LUM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
LUM Antibody
1-CSB-PA013234GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Lum Antibody
1-CSB-PA013234LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
LUM Antibody
ABD7293 100 ug
EUR 438
LUM ELISA Kit (Human) : 96 Wells (OKEH02823)
OKEH02823 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL
Human Lumican (LUM) CLIA Kit
abx195959-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Lumican (LUM) CLIA Kit
20-abx492810
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
General oxytocin ELISA Kit
ELA-E1052GELA-E 96 Tests
EUR 928
General SAM ELISA Kit
ELA-E14920GELA-E 96 Tests
EUR 928
General Cysteine ELISA Kit
ELA-E9193GELA-E 96 Tests
EUR 928
General Histamine ELISA KIT
ELI-03048Ge 96 Tests
EUR 886
General PYD ELISA KIT
ELI-03339Ge 96 Tests
EUR 886
General Calcitriol ELISA Kit
CELI-66118Ge 96 Tests
EUR 886
General Acetylcholine ELISA Kit
RD-ACH-Ge-48Tests 48 Tests
EUR 579
General Acetylcholine ELISA Kit
RD-ACH-Ge-96Tests 96 Tests
EUR 806
General Creatinine ELISA Kit
RDR-Crtn-Ge-48Tests 48 Tests
EUR 488
General Creatinine ELISA Kit
RDR-Crtn-Ge-96Tests 96 Tests
EUR 676
General Creatinine ELISA Kit
RD-Crtn-Ge-48Tests 48 Tests
EUR 467
General Creatinine ELISA Kit
RD-Crtn-Ge-96Tests 96 Tests
EUR 646
LUM Blocking Peptide
33R-1163 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C9orf96 antibody, catalog no. 70R-1210
Rat Lumican (Lum)
1-CSB-EP013234RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Lumican(Lum) expressed in E.coli
Rat Lumican (Lum)
1-CSB-MP013234RA
  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Lumican(Lum) expressed in Mammalian cell
LUM Blocking Peptide
DF7293-BP 1mg
EUR 195
Lumican (LUM) Antibody
20-abx213779
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
20-abx214200
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
20-abx100111
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Lumican (LUM) Antibody
20-abx100112
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Lumican (LUM) Antibody
20-abx113541
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
20-abx131975
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Lumican (LUM) Antibody
abx033510-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
abx033510-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
abx033511-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
abx033511-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
LUM Conjugated Antibody
C36591 100ul
EUR 397
Lumican (Lum) Antibody
20-abx319736
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
20-abx320659
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
abx234890-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Lumican (LUM) Antibody
20-abx225270
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
LUM cloning plasmid
CSB-CL013234HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgagtctaagtgcatttactctcttcctggcattgattggtggtaccagtggccagtactatgattatgattttcccctatcaatttatgggcaatcatcaccaaactgtgcaccagaatgtaactgccctgaaagctacccaagtgccatgtactgtgatgagctgaaattga
  • Show more
Description: A cloning plasmid for the LUM gene.
LUM cloning plasmid
CSB-CL013234HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgagtctaagtgcatttactctcttcctggcattgattggtggtaccagtggccagtactatgattatgattttcccctatcaatttatgggcaatcatcaccaaactgtgcaccagaatgtaactgccctgaaagctacccaagtgccatgtactgtgatgagctgaaattga
  • Show more
Description: A cloning plasmid for the LUM gene.
LUM Rabbit pAb
A5352-100ul 100 ul
EUR 308
LUM Rabbit pAb
A5352-200ul 200 ul
EUR 459
LUM Rabbit pAb
A5352-20ul 20 ul
EUR 183
LUM Rabbit pAb
A5352-50ul 50 ul
EUR 223
LUM Polyclonal Antibody
ABP59166-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
LUM Polyclonal Antibody
ABP59166-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
LUM Polyclonal Antibody
ABP59166-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
LUM Polyclonal Antibody
ES11180-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LUM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
LUM Polyclonal Antibody
ES11180-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LUM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Recombinant Lumican (LUM)
4-RPB496Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51884
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.1kDa
  • Isoelectric Point: 6.3
Description: Recombinant Human Lumican expressed in: E.coli
Recombinant Lumican (LUM)
4-RPB496Mu01
  • EUR 470.94
  • EUR 229.00
  • EUR 1491.04
  • EUR 563.68
  • EUR 1027.36
  • EUR 378.00
  • EUR 3577.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51885
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.8kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Lumican expressed in: E.coli
Anti-LUM antibody
STJ27305 100 µl
EUR 277
Description: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair.
Anti-LUM antibody
STJ192338 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LUM
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
General ACH/ Acetylcholine ELISA Kit
E0002Ge 1 Kit
EUR 717
General ANDRO/ Androstenedione ELISA Kit
E0004Ge 1 Kit
EUR 717
General ARG/ Arginine ELISA Kit
E0007Ge 1 Kit
EUR 717
General Biopterin/ Biopterin ELISA Kit
E0008Ge 1 Kit
EUR 717
General Calcitriol/ Calcitriol ELISA Kit
E0009Ge 1 Kit
EUR 717
General CH/ Cholesterol ELISA Kit
E0012Ge 1 Kit
EUR 717
General cholyglycine/ cholyglycine ELISA Kit
E0013Ge 1 Kit
EUR 717
General CORTI/ Corticosterone ELISA Kit
E0015Ge 1 Kit
EUR 717
General Cortisol/ Cortisol ELISA Kit
E0016Ge 1 Kit
EUR 485
General Cr/ Creatinine ELISA Kit
E0017Ge 1 Kit
EUR 563
General CRO/ Cortisone ELISA Kit
E0018Ge 1 Kit
EUR 717
General CsA/ Ciclosporin ELISA Kit
E0020Ge 1 Kit
EUR 717
General Cys/ Cysteine ELISA Kit
E0022Ge 1 Kit
EUR 717
General DAG/ Diacylglycerol ELISA Kit
E0023Ge 1 Kit
EUR 717
General DHEA/ Dehydroepiandrosterone ELISA Kit
E0024Ge 1 Kit
EUR 717
General DHT/ Dihydrotestosterone ELISA Kit
E0026Ge 1 Kit
EUR 717
General DPD/ Deoxypyridinoline ELISA Kit
E0027Ge 1 Kit
EUR 717
General E1/ Estrone ELISA Kit
E0028Ge 1 Kit
EUR 717
General E2/ Estradiol ELISA Kit
E0029Ge 1 Kit
EUR 485
General E3/ Estriol ELISA Kit
E0030Ge 1 Kit
EUR 717
General FK506/ Tacrolimus ELISA Kit
E0032Ge 1 Kit
EUR 717
General Gln/ Glutamine ELISA Kit
E0034Ge 1 Kit
EUR 717
General GSH/ Glutathione ELISA Kit
E0035Ge 1 Kit
EUR 717
General Hcy/ Homocysteine ELISA Kit
E0037Ge 1 Kit
EUR 717
General HIS/ Histamine ELISA Kit
E0038Ge 1 Kit
EUR 717
General Hyl/ Hydroxylysine ELISA Kit
E0041Ge 1 Kit
EUR 717
General HYP/ Hydroxyproline ELISA Kit
E0042Ge 1 Kit
EUR 717
General LAM/ Lipoarabinomannan ELISA Kit
E0045Ge 1 Kit
EUR 717
General LPS/ Lipopolysaccharide ELISA Kit
E0046Ge 1 Kit
EUR 717
General MDA/ Malondialdehyde ELISA Kit
E0048Ge 1 Kit
EUR 717
General MT/ Melatonin ELISA Kit
E0050Ge 1 Kit
EUR 717
General NT/ Nitrotyrosine ELISA Kit
E0051Ge 1 Kit
EUR 717
General P4/ Progesterone ELISA Kit
E0052Ge 1 Kit
EUR 451
General Pentosidine/ Pentosidine ELISA Kit
E0054Ge 1 Kit
EUR 717
General PS/ Phosphatidylserine ELISA Kit
E0058Ge 1 Kit
EUR 717
General PYD/ Pyridinoline ELISA Kit
E0059Ge 1 Kit
EUR 717
General SPH/ Sphingosine ELISA Kit
E0061Ge 1 Kit
EUR 717
General T3/ Triiodothyronine ELISA Kit
E0062Ge 1 Kit
EUR 451
General T4/ Thyroxine ELISA Kit
E0063Ge 1 Kit
EUR 451
General Testosterone/ Testosterone ELISA Kit
E0064Ge 1 Kit
EUR 451
General TGC/ Triglyceride ELISA Kit
E0065Ge 1 Kit
EUR 717
General THB/ Tetrahydrobiopterin ELISA Kit
E0066Ge 1 Kit
EUR 717
General VAL/ Valine ELISA Kit
E0070Ge 1 Kit
EUR 717
General VK1/ Phylloquinone ELISA Kit
E0075Ge 1 Kit
EUR 717
General 5HT/ Serotonin ELISA Kit
E0079Ge 1 Kit
EUR 563
General ALD/ Aldosterone ELISA Kit
E0085Ge 1 Kit
EUR 546
General AP/ Allopregnanolone ELISA Kit
E0087Ge 1 Kit
EUR 717
General DA/ Dopamine ELISA Kit
E0090Ge 1 Kit
EUR 717
General EPI/ Epinephrine ELISA Kit
E0091Ge 1 Kit
EUR 717
General ET/ Endotoxin ELISA Kit
E0092Ge 1 Kit
EUR 717
General FTA/ Fructosamine ELISA Kit
E0093Ge 1 Kit
EUR 717
General MN/ Mannose ELISA Kit
E0096Ge 1 Kit
EUR 717
General NA/ Noradrenaline ELISA Kit
E0097Ge 1 Kit
EUR 717
General Oxtc/ Oxytocin ELISA Kit
E0098Ge 1 Kit
EUR 717
General PGI2/ Prostacyclin ELISA Kit
E0099Ge 1 Kit
EUR 717
ELISA kit for General Glutathione
EK4923 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Glutathione in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Oxytocin
EK5045 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Oxytocin in samples from serum, plasma, tissue homogenates and other biological fluids.
General Cyclic Diguanylate ELISA Kit
ELA-E0153GE 96 Tests
EUR 928
ELISA kit for General Thyroxine
EK1787 96 tests
EUR 284
Description: Enzyme-linked immunosorbent assay kit for quantification of General Thyroxine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Triiodothyronine
EK1788 96 tests
EUR 284
Description: Enzyme-linked immunosorbent assay kit for quantification of General Triiodothyronine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Estriol
EK1790 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Estriol in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Androstenedione
EK1791 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Androstenedione in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Testosterone
EK1792 96 tests
EUR 284
Description: Enzyme-linked immunosorbent assay kit for quantification of General Testosterone in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Progesterone
EK1793 96 tests
EUR 284
Description: Enzyme-linked immunosorbent assay kit for quantification of General Progesterone in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Estradiol
EK1795 96 tests
EUR 351
Description: Enzyme-linked immunosorbent assay kit for quantification of General Estradiol in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Calcitriol
EK1804 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Calcitriol in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Prostacyclin
EK2185 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Prostacyclin in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Hydroxylysine
EK2196 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Hydroxylysine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Homocysteine
EK2228 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Homocysteine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Serotonin
EK2268 96 tests
EUR 502
Description: Enzyme-linked immunosorbent assay kit for quantification of General Serotonin in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Endotoxin
EK2290 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Endotoxin in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Dopamine
EK2355 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Dopamine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Epinephrine
EK2362 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Epinephrine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Deoxypyridinoline
EK2414 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Deoxypyridinoline in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Noradrenaline
EK2432 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Noradrenaline in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Melatonin
EK2433 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Melatonin in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Aldosterone
EK2437 96 tests
EUR 469
Description: Enzyme-linked immunosorbent assay kit for quantification of General Aldosterone in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Acetylcholine
EK2438 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Acetylcholine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Phylloquinone
EK2447 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Phylloquinone in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Histamine
EK2448 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Histamine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Pyridinoline
EK2608 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Pyridinoline in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Cysteine
EK2817 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Cysteine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Tacrolimus
EK2957 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Tacrolimus in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Lipopolysaccharide
EK3762 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Lipopolysaccharide in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Mannose
EK3774 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Mannose in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Lipoarabinomannan
EK3775 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Lipoarabinomannan in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Triglyceride
EK3875 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Triglyceride in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Cholesterol
EK3888 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Cholesterol in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Nitrotyrosine
EK4027 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Nitrotyrosine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Phosphatidylserine
EK4045 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Phosphatidylserine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Arginine
EK4106 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Arginine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Allopregnanolone
EK4128 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Allopregnanolone in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Diacylglycerol
EK4216 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Diacylglycerol in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Estrone
EK4250 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Estrone in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Valine
EK4328 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Valine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Tetrahydrobiopterin
EK4336 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Tetrahydrobiopterin in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Glutamine
EK4340 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Glutamine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Biopterin
EK4342 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Biopterin in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Sphingosine
EK4344 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Sphingosine in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for General Fructosamine
EK4351 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Fructosamine in samples from serum, plasma, tissue homogenates and other biological fluids.

General Lum(Lumisterol) ELISA Kit