General Lum(Lumisterol) ELISA Kit

General Lum(Lumisterol) ELISA Kit

To Order Contact us: [email protected]

General Lumisterol (Lum) ELISA Kit
CES509Ge-5x96wellstestplate 5x96-wells test plate
EUR 3261.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Lumisterol (Lum) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Lumisterol (Lum) in serum, plasma and other biological fluids.
General Lumisterol (Lum) ELISA Kit
4-CES509Ge
  • EUR 6078.00
  • EUR 3212.00
  • EUR 792.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lumisterol elisa. Alternative names of the recognized antigen: VD
  • VD1
  • Lamisterol
  • Vitamin D
  • Vitamin D1
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Lumisterol (Lum) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for General Lum (Lumisterol)
ELK7984 1 plate of 96 wells
EUR 372
  • A monoclonal antibody specific to Lumisterol (Lum) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Lumisterol (Lum) and unlabeled Lumisterol (Lum) (Standards or samples) with the pre-coated
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Lumisterol from General in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Lumican (LUM) ELISA Kit
DLR-LUM-Hu-48T 48T
EUR 498
  • Should the Human Lumican (LUM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lumican (LUM) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Lumican (LUM) ELISA Kit
DLR-LUM-Hu-96T 96T
EUR 647
  • Should the Human Lumican (LUM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lumican (LUM) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Lumican (LUM) ELISA Kit
RD-LUM-Hu-48Tests 48 Tests
EUR 500
Human Lumican (LUM) ELISA Kit
RD-LUM-Hu-96Tests 96 Tests
EUR 692
Human Lumican (LUM) ELISA Kit
RDR-LUM-Hu-48Tests 48 Tests
EUR 522
Human Lumican (LUM) ELISA Kit
RDR-LUM-Hu-96Tests 96 Tests
EUR 724
Vitamin D (Lumisterol) ELISA Kit
20-abx150388
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Lum/ Rat Lum ELISA Kit
ELI-04935r 96 Tests
EUR 886
Vitamin D (Lumisterol) CLIA Kit
20-abx490551
  • EUR 9242.00
  • EUR 4920.00
  • EUR 1130.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human LUM ELISA Kit
ELA-E1496h 96 Tests
EUR 824
LUM ELISA KIT|Human
EF000178 96 Tests
EUR 689
Cow Lumican (LUM) ELISA Kit
abx517282-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Chicken Lumican (LUM) ELISA Kit
abx517283-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Lumican (LUM) ELISA Kit
abx517285-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Lumican (LUM) ELISA Kit
abx573449-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Lum/ Lumican ELISA Kit
E0582Ra 1 Kit
EUR 571
Mouse Lum/ Lumican ELISA Kit
E0904Mo 1 Kit
EUR 571
Human LUM/ Lumican ELISA Kit
E1518Hu 1 Kit
EUR 571
Human LUM(Lumican) ELISA Kit
EH0220 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P51884
  • Alias: Lumican/LUM/LDC/SLRR2D
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Bovine Lumican, LUM ELISA KIT
ELI-04933b 96 Tests
EUR 928
Mouse Lumican, Lum ELISA KIT
ELI-04934m 96 Tests
EUR 865
Rabbit Lumican, LUM ELISA KIT
ELI-04936Ra 96 Tests
EUR 928
Chicken Lumican, LUM ELISA KIT
ELI-04937c 96 Tests
EUR 928
Human Lumican, LUM ELISA KIT
ELI-04938h 96 Tests
EUR 824
Human lumican(LUM)ELISA Kit
GA-E1888HM-48T 48T
EUR 289
Human lumican(LUM)ELISA Kit
GA-E1888HM-96T 96T
EUR 466
Rat Lum(Lumican) ELISA Kit
ER0046 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P51886
  • Alias: Lumican/LUM/LDC/SLRR2D/Keratan sulfate proteoglycan lumican/KSPG lumican
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml
Human Lumican (LUM) ELISA Kit
20-abx152244
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Lumican (LUM) ELISA Kit
abx350774-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Chicken Lumican (LUM) ELISA Kit
abx354656-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Lumican (LUM) ELISA Kit
abx354948-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Lumican (LUM) ELISA Kit
abx355098-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Lumican (LUM) ELISA Kit
abx355262-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Lumican (Lum) ELISA Kit
abx255626-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Lumican (LUM) ELISA Kit
abx251541-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human lumican,LUM ELISA Kit
201-12-1872 96 tests
EUR 440
  • This lumican ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Mouse Lumican(LUM) ELISA kit
CSB-EL013234MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lumican (LUM) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Lumican(LUM) ELISA kit
1-CSB-EL013234MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lumican(LUM) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Lumican(LUM) ELISA kit
CSB-EL013234RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Lumican (LUM) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rat Lumican(LUM) ELISA kit
1-CSB-EL013234RA
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Lumican(LUM) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human lumican, LUM ELISA Kit
CSB-E09797h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human lumican, LUM in samples from serum, urine, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human lumican, LUM ELISA Kit
1-CSB-E09797h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human lumican, LUM in samples from serum, urine, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Lumican (LUM) ELISA Kit
SEB496Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Lumican (LUM) ELISA Kit
SEB496Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Lumican (LUM) ELISA Kit
SEB496Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Lumican (LUM) ELISA Kit
SEB496Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Lumican (LUM) ELISA Kit
4-SEB496Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lumican elisa. Alternative names of the recognized antigen: LDC
  • SLRR2D
  • KSPG lumican
  • Keratan sulfate proteoglycan lumican
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lumican (LUM) in samples from Tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human lumican(LUM)ELISA Kit
QY-E03003 96T
EUR 361
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Lum ELISA Kit| Rat Lumican ELISA Kit
EF017042 96 Tests
EUR 689
ELISA kit for Human LUM (Lumican)
ELK2021 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lumican (LUM). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lumican (LUM). Next,
  • Show more
Description: A sandwich ELISA kit for detection of Lumican from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Guinea pig Lumican (LUM) ELISA Kit
abx354788-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
ELISA kit for Mouse LUM (Lumican)
E-EL-M1309 1 plate of 96 wells
EUR 534
  • Gentaur's LUM ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse LUM. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse LUM (Lumican) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human LUM (Lumican)
E-EL-H0198 1 plate of 96 wells
EUR 534
  • Gentaur's LUM ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human LUM. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human LUM (Lumican) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human Lumican (LUM)
KTE62236-48T 48T
EUR 354
  • Lumican is a member of the small leucine-rich proteoglycan family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. The protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lumican (LUM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Lumican (LUM)
KTE62236-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Lumican is a member of the small leucine-rich proteoglycan family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. The protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lumican (LUM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Lumican (LUM)
KTE62236-96T 96T
EUR 572
  • Lumican is a member of the small leucine-rich proteoglycan family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. The protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lumican (LUM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
LUM antibody
70R-9283 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LUM antibody
LUM Antibody
ABD7293 100 ug
EUR 438
LUM Antibody
36591-100ul 100ul
EUR 252
LUM antibody
70R-18332 50 ul
EUR 435
Description: Rabbit polyclonal LUM antibody
LUM Antibody
DF7293 200ul
EUR 304
Description: LUM Antibody detects endogenous levels of total LUM.
LUM Antibody
1-CSB-PA013234ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LUM. Recognizes LUM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
LUM Antibody
1-CSB-PA013234GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Lum Antibody
1-CSB-PA013234LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
LUM Antibody
1-CSB-PA781691
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
LUM Antibody
1-CSB-PA788951
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
Human Lumican (LUM) CLIA Kit
abx195959-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Lumican (LUM) CLIA Kit
20-abx492810
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
General oxytocin ELISA Kit
ELA-E1052GELA-E 96 Tests
EUR 928
General SAM ELISA Kit
ELA-E14920GELA-E 96 Tests
EUR 928
General Cysteine ELISA Kit
ELA-E9193GELA-E 96 Tests
EUR 928
General Histamine ELISA KIT
ELI-03048Ge 96 Tests
EUR 886
General PYD ELISA KIT
ELI-03339Ge 96 Tests
EUR 886
General Calcitriol ELISA Kit
CELI-66118Ge 96 Tests
EUR 886
General Acetylcholine ELISA Kit
RD-ACH-Ge-48Tests 48 Tests
EUR 579
General Acetylcholine ELISA Kit
RD-ACH-Ge-96Tests 96 Tests
EUR 806
General Creatinine ELISA Kit
RDR-Crtn-Ge-48Tests 48 Tests
EUR 488
General Creatinine ELISA Kit
RDR-Crtn-Ge-96Tests 96 Tests
EUR 676
General Creatinine ELISA Kit
RD-Crtn-Ge-48Tests 48 Tests
EUR 467
General Creatinine ELISA Kit
RD-Crtn-Ge-96Tests 96 Tests
EUR 646
LUM Conjugated Antibody
C36591 100ul
EUR 397
LUM cloning plasmid
CSB-CL013234HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgagtctaagtgcatttactctcttcctggcattgattggtggtaccagtggccagtactatgattatgattttcccctatcaatttatgggcaatcatcaccaaactgtgcaccagaatgtaactgccctgaaagctacccaagtgccatgtactgtgatgagctgaaattga
  • Show more
Description: A cloning plasmid for the LUM gene.
LUM cloning plasmid
CSB-CL013234HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgagtctaagtgcatttactctcttcctggcattgattggtggtaccagtggccagtactatgattatgattttcccctatcaatttatgggcaatcatcaccaaactgtgcaccagaatgtaactgccctgaaagctacccaagtgccatgtactgtgatgagctgaaattga
  • Show more
Description: A cloning plasmid for the LUM gene.
LUM Polyclonal Antibody
ES11180-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LUM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
LUM Polyclonal Antibody
ES11180-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LUM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Lumican (LUM) Antibody
20-abx113541
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
20-abx131975
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
LUM Polyclonal Antibody
ABP59166-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
LUM Polyclonal Antibody
ABP59166-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
LUM Polyclonal Antibody
ABP59166-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
Lumican (LUM) Antibody
20-abx100111
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Lumican (LUM) Antibody
20-abx100112
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Lumican (LUM) Antibody
abx033510-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
abx033510-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
abx033511-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
abx033511-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Lumican (Lum) Antibody
20-abx319736
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
20-abx320659
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
20-abx213779
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
20-abx214200
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lumican (LUM) Antibody
abx234890-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Lumican (LUM) Antibody
20-abx225270
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
LUM Rabbit pAb
A5352-100ul 100 ul
EUR 308
LUM Rabbit pAb
A5352-200ul 200 ul
EUR 459
LUM Rabbit pAb
A5352-20ul 20 ul
EUR 183
LUM Rabbit pAb
A5352-50ul 50 ul
EUR 223
LUM Blocking Peptide
33R-1163 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C9orf96 antibody, catalog no. 70R-1210
LUM Blocking Peptide
DF7293-BP 1mg
EUR 195
Rat Lumican (Lum)
1-CSB-EP013234RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Lumican(Lum) expressed in E.coli
Rat Lumican (Lum)
1-CSB-MP013234RA
  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Lumican(Lum) expressed in Mammalian cell
Recombinant Lumican (LUM)
4-RPB496Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51884
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.1kDa
  • Isoelectric Point: 6.3
Description: Recombinant Human Lumican expressed in: E.coli
Recombinant Lumican (LUM)
4-RPB496Mu01
  • EUR 470.94
  • EUR 229.00
  • EUR 1491.04
  • EUR 563.68
  • EUR 1027.36
  • EUR 378.00
  • EUR 3577.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51885
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.8kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Lumican expressed in: E.coli
Anti-LUM antibody
STJ27305 100 µl
EUR 277
Description: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair.
Anti-LUM antibody
STJ192338 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LUM
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
General Dopamine (DA) ELISA Kit
CEA851Ge-10x96wellstestplate 10x96-wells test plate
EUR 5359.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Dopamine (DA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Dopamine (DA) in serum, plasma and other biological fluids.
General Dopamine (DA) ELISA Kit
CEA851Ge-1x48wellstestplate 1x48-wells test plate
EUR 529.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Dopamine (DA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Dopamine (DA) in serum, plasma and other biological fluids.
General Dopamine (DA) ELISA Kit
CEA851Ge-1x96wellstestplate 1x96-wells test plate
EUR 712.92
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Dopamine (DA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Dopamine (DA) in serum, plasma and other biological fluids.
General Dopamine (DA) ELISA Kit
CEA851Ge-5x96wellstestplate 5x96-wells test plate
EUR 2908.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Dopamine (DA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Dopamine (DA) in serum, plasma and other biological fluids.
General Dopamine (DA) ELISA Kit
4-CEA851Ge
  • EUR 5410.00
  • EUR 2859.00
  • EUR 713.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dopamine elisa. Alternative names of the recognized antigen: 2-(3, 4-Dihydroxyphenyl)ethylamine
  • 3, 4-Dihydroxyphenethylamine
  • 3-Hydroxytyramine
  • Intropin
  • Revivan
  • Oxytyramine
  • Dopamine Hydrochloride
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Dopamine (DA) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
General Epinephrine (EPI) ELISA Kit
CEA858Ge-10x96wellstestplate 10x96-wells test plate
EUR 5359.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Epinephrine (EPI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Epinephrine (EPI) in serum, plasma, cell lysates, cell culture supernates and other biological fluids.
General Epinephrine (EPI) ELISA Kit
CEA858Ge-1x48wellstestplate 1x48-wells test plate
EUR 529.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Epinephrine (EPI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Epinephrine (EPI) in serum, plasma, cell lysates, cell culture supernates and other biological fluids.
General Epinephrine (EPI) ELISA Kit
CEA858Ge-1x96wellstestplate 1x96-wells test plate
EUR 712.92
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Epinephrine (EPI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Epinephrine (EPI) in serum, plasma, cell lysates, cell culture supernates and other biological fluids.
General Epinephrine (EPI) ELISA Kit
CEA858Ge-5x96wellstestplate 5x96-wells test plate
EUR 2908.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Epinephrine (EPI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Epinephrine (EPI) in serum, plasma, cell lysates, cell culture supernates and other biological fluids.
General Epinephrine (EPI) ELISA Kit
4-CEA858Ge
  • EUR 5410.00
  • EUR 2859.00
  • EUR 713.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Epinephrine elisa. Alternative names of the recognized antigen: Adrenaline
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Epinephrine (EPI) in samples from serum, plasma, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Noradrenaline (NE) ELISA Kit
CEA907Ge-10x96wellstestplate 10x96-wells test plate
EUR 5359.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Noradrenaline (NE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Noradrenaline (NE) in serum, plasma, cell lysates, cell culture supernates and other biological fluids.
General Noradrenaline (NE) ELISA Kit
CEA907Ge-1x48wellstestplate 1x48-wells test plate
EUR 529.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Noradrenaline (NE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Noradrenaline (NE) in serum, plasma, cell lysates, cell culture supernates and other biological fluids.
General Noradrenaline (NE) ELISA Kit
CEA907Ge-1x96wellstestplate 1x96-wells test plate
EUR 712.92
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Noradrenaline (NE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Noradrenaline (NE) in serum, plasma, cell lysates, cell culture supernates and other biological fluids.
General Noradrenaline (NE) ELISA Kit
CEA907Ge-5x96wellstestplate 5x96-wells test plate
EUR 2908.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Noradrenaline (NE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Noradrenaline (NE) in serum, plasma, cell lysates, cell culture supernates and other biological fluids.
General Noradrenaline (NE) ELISA Kit
4-CEA907Ge
  • EUR 5410.00
  • EUR 2859.00
  • EUR 713.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Noradrenaline elisa. Alternative names of the recognized antigen: NA
  • NAd
  • Norepinephrine
  • Norepi
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Noradrenaline (NE) in samples from serum, plasma, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Melatonin (MT) ELISA Kit
CEA908Ge-10x96wellstestplate 10x96-wells test plate
EUR 5359.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Melatonin (MT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Melatonin (MT) in serum, plasma and other biological fluids.
General Melatonin (MT) ELISA Kit
CEA908Ge-1x48wellstestplate 1x48-wells test plate
EUR 529.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Melatonin (MT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Melatonin (MT) in serum, plasma and other biological fluids.
General Melatonin (MT) ELISA Kit
CEA908Ge-1x96wellstestplate 1x96-wells test plate
EUR 712.92
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Melatonin (MT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Melatonin (MT) in serum, plasma and other biological fluids.
General Melatonin (MT) ELISA Kit
CEA908Ge-5x96wellstestplate 5x96-wells test plate
EUR 2908.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Melatonin (MT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Melatonin (MT) in serum, plasma and other biological fluids.
General Melatonin (MT) ELISA Kit
4-CEA908Ge
  • EUR 5410.00
  • EUR 2859.00
  • EUR 713.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Melatonin elisa. Alternative names of the recognized antigen: N-Acetyl-5-Methoxytryptamine
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Melatonin (MT) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
General Aldosterone (ALD) ELISA Kit
CEA911Ge-10x96wellstestplate 10x96-wells test plate
EUR 5359.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Aldosterone (ALD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Aldosterone (ALD) in serum, plasma and other biological fluids.
General Aldosterone (ALD) ELISA Kit
CEA911Ge-1x48wellstestplate 1x48-wells test plate
EUR 529.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Aldosterone (ALD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Aldosterone (ALD) in serum, plasma and other biological fluids.
General Aldosterone (ALD) ELISA Kit
CEA911Ge-1x96wellstestplate 1x96-wells test plate
EUR 712.92
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Aldosterone (ALD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Aldosterone (ALD) in serum, plasma and other biological fluids.
General Aldosterone (ALD) ELISA Kit
CEA911Ge-5x96wellstestplate 5x96-wells test plate
EUR 2908.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Aldosterone (ALD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Aldosterone (ALD) in serum, plasma and other biological fluids.
General Aldosterone (ALD) ELISA Kit
4-CEA911Ge
  • EUR 5410.00
  • EUR 2859.00
  • EUR 713.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Aldosterone elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Aldosterone (ALD) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
General Acetylcholine (ACH) ELISA Kit
CEA912Ge-10x96wellstestplate 10x96-wells test plate
EUR 5359.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Acetylcholine (ACH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Acetylcholine (ACH) in serum, plasma and other biological fluids.
General Acetylcholine (ACH) ELISA Kit
CEA912Ge-1x48wellstestplate 1x48-wells test plate
EUR 529.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Acetylcholine (ACH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Acetylcholine (ACH) in serum, plasma and other biological fluids.
General Acetylcholine (ACH) ELISA Kit
CEA912Ge-1x96wellstestplate 1x96-wells test plate
EUR 712.92
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Acetylcholine (ACH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Acetylcholine (ACH) in serum, plasma and other biological fluids.
General Acetylcholine (ACH) ELISA Kit
CEA912Ge-5x96wellstestplate 5x96-wells test plate
EUR 2908.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Acetylcholine (ACH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Acetylcholine (ACH) in serum, plasma and other biological fluids.
General Acetylcholine (ACH) ELISA Kit
4-CEA912Ge
  • EUR 5410.00
  • EUR 2859.00
  • EUR 713.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Acetylcholine elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Acetylcholine (ACH) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
General Cyanocobalamin (CNCbl) ELISA Kit
CEA924Ge-10x96wellstestplate 10x96-wells test plate
EUR 5359.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Cyanocobalamin (CNCbl) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Cyanocobalamin (CNCbl) in serum, plasma, tissue homogenates and other biological fluids.
General Cyanocobalamin (CNCbl) ELISA Kit
CEA924Ge-1x48wellstestplate 1x48-wells test plate
EUR 529.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Cyanocobalamin (CNCbl) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Cyanocobalamin (CNCbl) in serum, plasma, tissue homogenates and other biological fluids.
General Cyanocobalamin (CNCbl) ELISA Kit
CEA924Ge-1x96wellstestplate 1x96-wells test plate
EUR 712.92
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Cyanocobalamin (CNCbl) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Cyanocobalamin (CNCbl) in serum, plasma, tissue homogenates and other biological fluids.
General Cyanocobalamin (CNCbl) ELISA Kit
CEA924Ge-5x96wellstestplate 5x96-wells test plate
EUR 2908.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Cyanocobalamin (CNCbl) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Cyanocobalamin (CNCbl) in serum, plasma, tissue homogenates and other biological fluids.
General Cyanocobalamin (CNCbl) ELISA Kit
4-CEA924Ge
  • EUR 5410.00
  • EUR 2859.00
  • EUR 713.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cyanocobalamin elisa. Alternative names of the recognized antigen: VB12
  • Vitamin B12
  • Cobalamin
  • α-5, 6-Dimethylbenzimidazolyl Cobamidcyanide
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Cyanocobalamin (CNCbl) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Histamine (HA) ELISA Kit
CEA927Ge-10x96wellstestplate 10x96-wells test plate
EUR 5359.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Histamine (HA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Histamine (HA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Histamine (HA) ELISA Kit
CEA927Ge-1x48wellstestplate 1x48-wells test plate
EUR 529.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Histamine (HA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Histamine (HA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Histamine (HA) ELISA Kit
CEA927Ge-1x96wellstestplate 1x96-wells test plate
EUR 712.92
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Histamine (HA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Histamine (HA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Histamine (HA) ELISA Kit
CEA927Ge-5x96wellstestplate 5x96-wells test plate
EUR 2908.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Histamine (HA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Histamine (HA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Histamine (HA) ELISA Kit
4-CEA927Ge
  • EUR 5410.00
  • EUR 2859.00
  • EUR 713.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histamine elisa. Alternative names of the recognized antigen: Histamin
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Histamine (HA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Estrone (E1) ELISA Kit
CEB003Ge-10x96wellstestplate 10x96-wells test plate
EUR 5438.36
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Estrone (E1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Estrone (E1) in serum, plasma and other biological fluids.
General Estrone (E1) ELISA Kit
CEB003Ge-1x48wellstestplate 1x48-wells test plate
EUR 535.51
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Estrone (E1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Estrone (E1) in serum, plasma and other biological fluids.
General Estrone (E1) ELISA Kit
CEB003Ge-1x96wellstestplate 1x96-wells test plate
EUR 722.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Estrone (E1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Estrone (E1) in serum, plasma and other biological fluids.
General Estrone (E1) ELISA Kit
CEB003Ge-5x96wellstestplate 5x96-wells test plate
EUR 2949.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Estrone (E1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Estrone (E1) in serum, plasma and other biological fluids.
General Estrone (E1) ELISA Kit
4-CEB003Ge
  • EUR 5489.00
  • EUR 2900.00
  • EUR 723.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Estrone elisa. Alternative names of the recognized antigen: Oestrone
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Estrone (E1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
General Oxytocin (OT) ELISA Kit
CEB052Ge-10x96wellstestplate 10x96-wells test plate
EUR 4378.07
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Oxytocin (OT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Oxytocin (OT) in serum, plasma and other biological fluids.
General Oxytocin (OT) ELISA Kit
CEB052Ge-1x48wellstestplate 1x48-wells test plate
EUR 448.19
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Oxytocin (OT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Oxytocin (OT) in serum, plasma and other biological fluids.
General Oxytocin (OT) ELISA Kit
CEB052Ge-1x96wellstestplate 1x96-wells test plate
EUR 597.42
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Oxytocin (OT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Oxytocin (OT) in serum, plasma and other biological fluids.
General Oxytocin (OT) ELISA Kit
CEB052Ge-5x96wellstestplate 5x96-wells test plate
EUR 2388.39
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Oxytocin (OT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Oxytocin (OT) in serum, plasma and other biological fluids.
General Oxytocin (OT) ELISA Kit
4-CEB052Ge
  • EUR 4429.00
  • EUR 2339.00
  • EUR 598.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Oxytocin elisa. Alternative names of the recognized antigen: Pitocin
  • Syntocinon
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Oxytocin (OT) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
General Carnosine (Car) ELISA Kit
CEB450Ge-10x96wellstestplate 10x96-wells test plate
EUR 5438.36
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Carnosine (Car) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Carnosine (Car) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Carnosine (Car) ELISA Kit
CEB450Ge-1x48wellstestplate 1x48-wells test plate
EUR 535.51
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Carnosine (Car) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Carnosine (Car) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Carnosine (Car) ELISA Kit
CEB450Ge-1x96wellstestplate 1x96-wells test plate
EUR 722.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Carnosine (Car) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Carnosine (Car) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Carnosine (Car) ELISA Kit
CEB450Ge-5x96wellstestplate 5x96-wells test plate
EUR 2949.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Carnosine (Car) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Carnosine (Car) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Carnosine (Car) ELISA Kit
4-CEB450Ge
  • EUR 5489.00
  • EUR 2900.00
  • EUR 723.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Carnosine elisa. Alternative names of the recognized antigen: β-Alanyl-L-Histidine
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Carnosine (Car) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Ovalbumin (OVA) ELISA Kit
CEB459Ge-10x96wellstestplate 10x96-wells test plate
EUR 2820.36
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Ovalbumin (OVA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Ovalbumin (OVA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Ovalbumin (OVA) ELISA Kit
CEB459Ge-1x48wellstestplate 1x48-wells test plate
EUR 319.91
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Ovalbumin (OVA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Ovalbumin (OVA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Ovalbumin (OVA) ELISA Kit
CEB459Ge-1x96wellstestplate 1x96-wells test plate
EUR 414.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Ovalbumin (OVA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Ovalbumin (OVA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Ovalbumin (OVA) ELISA Kit
CEB459Ge-5x96wellstestplate 5x96-wells test plate
EUR 1563.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Ovalbumin (OVA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Ovalbumin (OVA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Ovalbumin (OVA) ELISA Kit
4-CEB459Ge
  • EUR 2871.00
  • EUR 1514.00
  • EUR 415.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ovalbumin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Ovalbumin (OVA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Lipopolysaccharide (LPS) ELISA Kit
CEB526Ge-10x96wellstestplate 10x96-wells test plate
EUR 6040.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Lipopolysaccharide (LPS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Lipopolysaccharide (LPS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Lipopolysaccharide (LPS) ELISA Kit
CEB526Ge-1x48wellstestplate 1x48-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Lipopolysaccharide (LPS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Lipopolysaccharide (LPS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Lipopolysaccharide (LPS) ELISA Kit
CEB526Ge-1x96wellstestplate 1x96-wells test plate
EUR 793
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Lipopolysaccharide (LPS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Lipopolysaccharide (LPS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Lipopolysaccharide (LPS) ELISA Kit
CEB526Ge-5x96wellstestplate 5x96-wells test plate
EUR 3268.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Lipopolysaccharide (LPS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Lipopolysaccharide (LPS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Lipopolysaccharide (LPS) ELISA Kit
4-CEB526Ge
  • EUR 6091.00
  • EUR 3219.00
  • EUR 794.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lipopolysaccharide elisa. Alternative names of the recognized antigen: LOS
  • Lipoglycans
  • Lipooligosaccharide
  • Lipo-Oligosaccharide
  • Endotoxin
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Lipopolysaccharide (LPS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Triglyceride (TG) ELISA Kit
CEB687Ge-10x96wellstestplate 10x96-wells test plate
EUR 5438.36
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Triglyceride (TG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Triglyceride (TG) in serum, plasma, tissue homogenates and other biological fluids.
General Triglyceride (TG) ELISA Kit
CEB687Ge-1x48wellstestplate 1x48-wells test plate
EUR 535.51
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Triglyceride (TG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Triglyceride (TG) in serum, plasma, tissue homogenates and other biological fluids.
General Triglyceride (TG) ELISA Kit
CEB687Ge-1x96wellstestplate 1x96-wells test plate
EUR 722.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Triglyceride (TG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Triglyceride (TG) in serum, plasma, tissue homogenates and other biological fluids.
General Triglyceride (TG) ELISA Kit
CEB687Ge-5x96wellstestplate 5x96-wells test plate
EUR 2949.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Triglyceride (TG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Triglyceride (TG) in serum, plasma, tissue homogenates and other biological fluids.
General Triglyceride (TG) ELISA Kit
4-CEB687Ge
  • EUR 5489.00
  • EUR 2900.00
  • EUR 723.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Triglyceride elisa. Alternative names of the recognized antigen: TAG
  • Triacylglycerol
  • Triacylglyceride
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Triglyceride (TG) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Cholesterol (CH) ELISA Kit
CEB701Ge-10x96wellstestplate 10x96-wells test plate
EUR 5844.15
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Cholesterol (CH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Cholesterol (CH) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Cholesterol (CH) ELISA Kit
CEB701Ge-1x48wellstestplate 1x48-wells test plate
EUR 568.93
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Cholesterol (CH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Cholesterol (CH) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Cholesterol (CH) ELISA Kit
CEB701Ge-1x96wellstestplate 1x96-wells test plate
EUR 769.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Cholesterol (CH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Cholesterol (CH) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Cholesterol (CH) ELISA Kit
CEB701Ge-5x96wellstestplate 5x96-wells test plate
EUR 3164.55
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Cholesterol (CH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Cholesterol (CH) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Cholesterol (CH) ELISA Kit
4-CEB701Ge
  • EUR 5895.00
  • EUR 3115.00
  • EUR 770.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cholesterol elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Cholesterol (CH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Nitrotyrosine (NT) ELISA Kit
CEB863Ge-10x96wellstestplate 10x96-wells test plate
EUR 5438.36
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nitrotyrosine (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nitrotyrosine (NT) in serum, plasma and other biological fluids.
General Nitrotyrosine (NT) ELISA Kit
CEB863Ge-1x48wellstestplate 1x48-wells test plate
EUR 535.51
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nitrotyrosine (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nitrotyrosine (NT) in serum, plasma and other biological fluids.
General Nitrotyrosine (NT) ELISA Kit
CEB863Ge-1x96wellstestplate 1x96-wells test plate
EUR 722.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nitrotyrosine (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nitrotyrosine (NT) in serum, plasma and other biological fluids.
General Nitrotyrosine (NT) ELISA Kit
CEB863Ge-5x96wellstestplate 5x96-wells test plate
EUR 2949.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nitrotyrosine (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nitrotyrosine (NT) in serum, plasma and other biological fluids.
General Nitrotyrosine (NT) ELISA Kit
4-CEB863Ge
  • EUR 5489.00
  • EUR 2900.00
  • EUR 723.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nitrotyrosine elisa. Alternative names of the recognized antigen: 3-Nitro-L-Tyrosine
  • 3-Nitrotyrosine
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Nitrotyrosine (NT) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
General Phosphatidylserine (PS) ELISA Kit
CEB881Ge-10x96wellstestplate 10x96-wells test plate
EUR 5438.36
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylserine (PS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylserine (PS) in serum, plasma and other biological fluids.
General Phosphatidylserine (PS) ELISA Kit
CEB881Ge-1x48wellstestplate 1x48-wells test plate
EUR 535.51
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylserine (PS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylserine (PS) in serum, plasma and other biological fluids.
General Phosphatidylserine (PS) ELISA Kit
CEB881Ge-1x96wellstestplate 1x96-wells test plate
EUR 722.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylserine (PS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylserine (PS) in serum, plasma and other biological fluids.
General Phosphatidylserine (PS) ELISA Kit
CEB881Ge-5x96wellstestplate 5x96-wells test plate
EUR 2949.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylserine (PS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylserine (PS) in serum, plasma and other biological fluids.
General Phosphatidylserine (PS) ELISA Kit
4-CEB881Ge
  • EUR 5489.00
  • EUR 2900.00
  • EUR 723.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phosphatidylserine elisa. Alternative names of the recognized antigen: Ptd-L-Ser
  • PtdSer
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Phosphatidylserine (PS) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
General Arginine (Arg) ELISA Kit
CEB938Ge-10x96wellstestplate 10x96-wells test plate
EUR 5438.36
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Arginine (Arg) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Arginine (Arg) in serum, plasma, tissue homogenates and other biological fluids.
General Arginine (Arg) ELISA Kit
CEB938Ge-1x48wellstestplate 1x48-wells test plate
EUR 535.51
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Arginine (Arg) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Arginine (Arg) in serum, plasma, tissue homogenates and other biological fluids.
General Arginine (Arg) ELISA Kit
CEB938Ge-1x96wellstestplate 1x96-wells test plate
EUR 722.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Arginine (Arg) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Arginine (Arg) in serum, plasma, tissue homogenates and other biological fluids.
General Arginine (Arg) ELISA Kit
CEB938Ge-5x96wellstestplate 5x96-wells test plate
EUR 2949.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Arginine (Arg) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Arginine (Arg) in serum, plasma, tissue homogenates and other biological fluids.
General Arginine (Arg) ELISA Kit
4-CEB938Ge
  • EUR 5489.00
  • EUR 2900.00
  • EUR 723.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Arginine elisa. Alternative names of the recognized antigen: (S)-2-Amino-5-Guanidinopentanoic Acid
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Arginine (Arg) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Allopregnanolone (AP) ELISA Kit
CEB963Ge-10x96wellstestplate 10x96-wells test plate
EUR 5438.36
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Allopregnanolone (AP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Allopregnanolone (AP) in serum, plasma and other biological fluids.
General Allopregnanolone (AP) ELISA Kit
CEB963Ge-1x48wellstestplate 1x48-wells test plate
EUR 535.51
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Allopregnanolone (AP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Allopregnanolone (AP) in serum, plasma and other biological fluids.
General Allopregnanolone (AP) ELISA Kit
CEB963Ge-1x96wellstestplate 1x96-wells test plate
EUR 722.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Allopregnanolone (AP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Allopregnanolone (AP) in serum, plasma and other biological fluids.
General Allopregnanolone (AP) ELISA Kit
CEB963Ge-5x96wellstestplate 5x96-wells test plate
EUR 2949.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Allopregnanolone (AP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Allopregnanolone (AP) in serum, plasma and other biological fluids.
General Allopregnanolone (AP) ELISA Kit
4-CEB963Ge
  • EUR 5489.00
  • EUR 2900.00
  • EUR 723.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Allopregnanolone elisa. Alternative names of the recognized antigen: THP
  • 3a, 5a-Tetrahydro Progesterone
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Allopregnanolone (AP) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
General Diacylglycerol (DAG) ELISA Kit
CEC038Ge-10x96wellstestplate 10x96-wells test plate
EUR 5490.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Diacylglycerol (DAG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Diacylglycerol (DAG) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Diacylglycerol (DAG) ELISA Kit
CEC038Ge-1x48wellstestplate 1x48-wells test plate
EUR 539.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Diacylglycerol (DAG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Diacylglycerol (DAG) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Diacylglycerol (DAG) ELISA Kit
CEC038Ge-1x96wellstestplate 1x96-wells test plate
EUR 728.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Diacylglycerol (DAG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Diacylglycerol (DAG) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Diacylglycerol (DAG) ELISA Kit
CEC038Ge-5x96wellstestplate 5x96-wells test plate
EUR 2977.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Diacylglycerol (DAG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Diacylglycerol (DAG) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Diacylglycerol (DAG) ELISA Kit
4-CEC038Ge
  • EUR 5541.00
  • EUR 2928.00
  • EUR 729.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diacylglycerol elisa. Alternative names of the recognized antigen: DG
  • Diglyceride
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Diacylglycerol (DAG) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
General Retinol (Ret) ELISA Kit
CED051Ge-10x96wellstestplate 10x96-wells test plate
EUR 5490.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Retinol (Ret) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Retinol (Ret) in serum, plasma and other biological fluids.
General Retinol (Ret) ELISA Kit
CED051Ge-1x48wellstestplate 1x48-wells test plate
EUR 539.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Retinol (Ret) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Retinol (Ret) in serum, plasma and other biological fluids.
General Retinol (Ret) ELISA Kit
CED051Ge-1x96wellstestplate 1x96-wells test plate
EUR 728.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Retinol (Ret) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Retinol (Ret) in serum, plasma and other biological fluids.
General Retinol (Ret) ELISA Kit
CED051Ge-5x96wellstestplate 5x96-wells test plate
EUR 2977.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Retinol (Ret) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Retinol (Ret) in serum, plasma and other biological fluids.
General Retinol (Ret) ELISA Kit
4-CED051Ge
  • EUR 5541.00
  • EUR 2928.00
  • EUR 729.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Retinol elisa. Alternative names of the recognized antigen: VA
  • Vitamin A
  • Aquasola
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Retinol (Ret) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
General Tryptophan (Trp) ELISA Kit
CED720Ge-10x96wellstestplate 10x96-wells test plate
EUR 5844.15
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Tryptophan (Trp) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Tryptophan (Trp) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

General Lum(Lumisterol) ELISA Kit