Rat RTN4(Reticulon 4) ELISA Kit

Rat RTN4(Reticulon 4) ELISA Kit

To Order Contact us: [email protected]

Human Reticulon 4 (RTN4) ELISA Kit

RD-RTN4-Hu-48Tests 48 Tests
EUR 521

Human Reticulon 4 (RTN4) ELISA Kit

RD-RTN4-Hu-96Tests 96 Tests
EUR 723

Rat Reticulon 4 (RTN4) ELISA Kit

abx255978-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat RTN4(Reticulon 4) ELISA Kit

ER1312 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9JK11
  • Alias: RTN4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

Rat Reticulon 4 (RTN4) CLIA Kit

abx197645-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Rat RTN4 (Reticulon 4)

E-EL-R1503 1 plate of 96 wells
EUR 534
  • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

Reticulon 4 (RTN4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reticulon 4 (RTN4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reticulon 4 (RTN4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody

abx002254-50ul 50 ul
EUR 356
  • Shipped within 5-10 working days.

Human Reticulon-4(RTN4) ELISA kit

CSB-EL020572HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 (RTN4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Reticulon-4(RTN4) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4(RTN4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Reticulon 4 (RTN4) ELISA Kit

abx051861-96tests 96 tests
EUR 786
  • Shipped within 5-10 working days.

Human Reticulon 4 (RTN4) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Reticulon 4 (RTN4) ELISA Kit

abx253120-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human RTN4(Reticulon 4) ELISA Kit

EH3732 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: Q9NQC3
  • Alias: RTN4/Reticulon-5/RTN-x/Neuroendocrine-specific protein C homolog/Neuroendocrine-specific protein(NSP)/Foocen/Neurite outgrowth inhibitor(Nogo protein)/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Mouse Reticulon- 4, Rtn4 ELISA KIT

ELI-20214m 96 Tests
EUR 865

Human Reticulon- 4, RTN4 ELISA KIT

ELI-52764h 96 Tests
EUR 824

Mouse Reticulon 4 (RTN4) ELISA Kit

abx353194-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Reticulon 4(RTN4)ELISA Kit

QY-E01104 96T
EUR 361

Human Reticulon 4 ELISA Kit (RTN4)

RK02217 96 Tests
EUR 521

Human Reticulon 4 (RTN4) ELISA Kit

SEF994Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit

SEF994Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit

SEF994Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit

SEF994Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulon 4 elisa. Alternative names of the recognized antigen: NSP
  • ASY
  • NOGO
  • NSP-CL
  • RTN-X
  • Reticulon-5
  • Foocen
  • Neurite outgrowth inhibitor
  • Neuroendocrine-specific protein
  • Neuroendocrine-specific protein C homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 (RTN4) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

RTN4 ELISA Kit| Rat Reticulon 4 ELISA Kit

EF018017 96 Tests
EUR 689

CLIA kit for Rat RTN4 (Reticulon 4)

E-CL-R0748 1 plate of 96 wells
EUR 584
  • Gentaur's RTN4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4 . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human RTN4 (Reticulon 4)

E-EL-H2535 1 plate of 96 wells
EUR 534
  • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse RTN4 (Reticulon 4)

E-EL-M1350 1 plate of 96 wells
EUR 534
  • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human RTN4 (Reticulon 4)

ELK4140 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 (RTN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticulon 4 (RT
  • Show more
Description: A sandwich ELISA kit for detection of Reticulon 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulon-4 (RTN4)

KTE60779-48T 48T
EUR 332
  • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 (RTN4)

KTE60779-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 (RTN4)

KTE60779-96T 96T
EUR 539
  • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Reticulon 4 (RTN4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Reticulon 4 (RTN4) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rtn4/ Rat Rtn4 ELISA Kit

ELI-15668r 96 Tests
EUR 886

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Reticulon- 4 receptor, Rtn4r ELISA KIT

ELI-18409m 96 Tests
EUR 865

Human Reticulon- 4 receptor, RTN4R ELISA KIT

ELI-29471h 96 Tests
EUR 824

Human Reticulon 4 Receptor(RTN4R)ELISA Kit

QY-E01103 96T
EUR 361

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulon 4 Receptor elisa. Alternative names of the recognized antigen: NGR
  • Nogo-66 Receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 Receptor (RTN4R) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Recombinant human Reticulon-4

P1398 100ug Ask for price
  • Uniprot ID: Q9NQC3
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Reticulon-4

RTN4 ELISA Kit (Rat) (OKEH07826)

OKEH07826 96 Wells
EUR 896
Description: Description of target: a myelin protein that is a potent inhibitor of neurite growth [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.6pg/mL

RTN4 ELISA Kit (Rat) (OKEI00899)

OKEI00899 96 Wells
EUR 767
Description: Description of target: Developmental neurite growth regulatory factor with a role as a negative regulator of axon-axon adhesion and growth, and as a facilitator of neurite branching. Regulates neurite fasciculation, branching and extension in the developing nervous system. Involved in down-regulation of growth, stabilization of wiring and restriction of plasticity in the adult CNS. Regulates the radial migration of cortical neurons via an RTN4R-LINGO1 containing receptor complex. Isoform 2 and isoform 3 inhibit BACE1 activity and amyloid precursor protein processing. Induces the formation and stabilization of endoplasmic reticulum (ER) tubules. Regulates membrane morphogenesis in the ER by promoting tubular ER production. Influences NE expansion, nuclear pore complex formation and proper localization of inner nuclear membrane proteins.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

ELISA kit for Human RTN4R (Reticulon 4 Receptor)

ELK5164 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 Receptor (RTN4R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Retic
  • Show more
Description: A sandwich ELISA kit for detection of Reticulon 4 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)

KTE60778-48T 48T
EUR 332
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)

KTE60778-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)

KTE60778-96T 96T
EUR 539
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Reticulon 4 Receptor (RTN4R) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.


EF010898 96 Tests
EUR 689

Mouse RTN4 ELISA Kit

STJ150544 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of RTN4 in Mouse serum, plasma and other biological fluids

Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit

CSB-EL020576HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2 (RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2(RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Reticulon- 4 receptor- like 2, Rtn4rl2 ELISA KIT

ELI-15500m 96 Tests
EUR 865

Human Reticulon- 4 receptor- like 2, RTN4RL2 ELISA KIT

ELI-30455h 96 Tests
EUR 824

Mouse Reticulon- 4 receptor- like 1, Rtn4rl1 ELISA KIT

ELI-52476m 96 Tests
EUR 865

Human Reticulon- 4 receptor- like 1, RTN4RL1 ELISA KIT

ELI-35842h 96 Tests
EUR 824

Rat RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)

ELI-20212r 96 Tests
EUR 886

Reticulon 4 Interacting Protein 1 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RTN4 ELISA Kit (Human) (OKAN06179)

OKAN06179 96 Wells
EUR 792
Description: Description of target: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL

RTN4 ELISA Kit (Mouse) (OKCA01764)

OKCA01764 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

RTN4 ELISA Kit (Human) (OKCD08873)

OKCD08873 96 Wells
EUR 975
Description: Description of target: RTN4 belongs to the family of reticulons. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. RTN4 is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates.This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

RTN4 ELISA Kit (Human) (OKDD00514)

OKDD00514 96 Wells
EUR 975
Description: Description of target: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.058 ng/mL

Liver Dissociation System 4 (Hepatocytes, rat), Rat

4-20304 ea Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

abx122324-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

abx032462-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

abx032462-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant human Reticulon-4 receptor-like 2

P1411 100ug Ask for price
  • Uniprot ID: Q86UN3
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Reticulon-4 receptor-like 2

RTN4R Reticulon 4 Receptor Human Recombinant Protein

PROTQ9BZR6 Regular: 10ug
EUR 317
Description: RTN4R produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 429 amino acids (27-447 a.a.) andhaving a molecular mass of 46.3kDa (Molecular size on SDS-PAGE will appear atapproximately 40-57 kDa). RTN4R is expressed with a 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques.

Rat FibrOut 4, for brain, neural

4-20533 1 ml Ask for price

Rat FibrOut 4, for brain, neural

4-20534 5 x 1 ml Ask for price

Rat RTN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RTN3(Reticulon-3) ELISA Kit

EH12024 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O95197
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Reticulon- 3, Rtn3 ELISA KIT

ELI-21595m 96 Tests
EUR 865

Human Reticulon 2 (RTN2) ELISA Kit

abx382990-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Reticulon 3 (RTN3) ELISA Kit

abx382991-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Reticulon- 2, RTN2 ELISA KIT

ELI-36391h 96 Tests
EUR 824

Mouse Reticulon- 2, Rtn2 ELISA KIT

ELI-38724m 96 Tests
EUR 865

Bovine Reticulon- 3, RTN3 ELISA KIT

ELI-41268b 96 Tests
EUR 928

Human Reticulon- 3, RTN3 ELISA KIT

ELI-41269h 96 Tests
EUR 824

Human Reticulon 3(RTN3)ELISA Kit

QY-E01105 96T
EUR 361

Human Reticulon 2(RTN2)ELISA Kit

QY-E01106 96T
EUR 361

Human Reticulon 1(RTN1)ELISA Kit

QY-E01107 96T
EUR 361

Thymus Dissociation System 4 (Epithelial), Adult rat

4-20444 ea Ask for price

RTN4 antibody

70R-20039 50 ul
EUR 435
Description: Rabbit polyclonal RTN4 antibody

RTN4 Antibody

37191-100ul 100ul
EUR 252

RTN4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

RTN4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:50-1:200

RTN4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

RTN4 antibody

70R-7137 50 ug
EUR 467
Description: Rabbit polyclonal RTN4 antibody raised against the middle region of RTN4

RTN4 antibody

70R-7139 50 ug
EUR 467
Description: Rabbit polyclonal RTN4 antibody raised against the middle region of RTN4

RTN4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody

abx122325-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cartilage Dissociation System 4 (Chondrocytes), Mouse and Rat

4-20234 ea Ask for price

Pancreas Dissociation System 4 (Islets), Mouse and Rat

4-20374 ea Ask for price

Skin Dissociation System 4 (Keratinocytes), Mouse and Rat

4-20434 ea Ask for price

Human RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)

ELI-29470h 96 Tests
EUR 824

Mouse RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)

ELI-53344m 96 Tests
EUR 865

IL-4 Interleukin 4 Human Recombinant Protein, Yeast

PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

Rtn4 ORF Vector (Rat) (pORF)

ORF075746 1.0 ug DNA
EUR 506

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Adipose/Fat Dissociation System 4 (Predipocytes), Mouse and Rat

4-20194 ea Ask for price

Brain Dissociation System 4 (Endothelial, Microvessels), Mouse and Rat

4-20224 ea Ask for price

Endothelial Dissociation System 4 (Endothelial,Cerebral), Mouse and Rat

4-20244 ea Ask for price

Heart Dissociation System 4 (Myocytes,Ventricles), Mouse and Rat

4-20274 ea Ask for price

Muscle Dissociation System 4 (Smooth muscle), Mouse and Rat

4-20334 ea Ask for price

Parotid Dissociation System 4 (Parotid acinar), Mouse and Rat

4-20394 ea Ask for price

Reticulon 1A antibody

10R-8103 100 ug
EUR 467
Description: Mouse monoclonal Reticulon 1A antibody

Reticulon 1A antibody

10R-8104 100 ug
EUR 467
Description: Mouse monoclonal Reticulon 1A antibody

Reticulon 1A antibody

10R-8105 100 ug
EUR 467
Description: Mouse monoclonal Reticulon 1A antibody

Reticulon 1C antibody

10R-8108 100 ug
EUR 435
Description: Mouse monoclonal Reticulon 1C antibody

anti-Reticulon 2

YF-PA14468 50 ul
EUR 363
Description: Mouse polyclonal to Reticulon 2

anti-Reticulon 2

YF-PA14469 50 ug
EUR 363
Description: Mouse polyclonal to Reticulon 2

anti-Reticulon 2

YF-PA14470 100 ug
EUR 403
Description: Rabbit polyclonal to Reticulon 2

anti-Reticulon 2

YF-PA24640 50 ul
EUR 334
Description: Mouse polyclonal to Reticulon 2

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-48Tests 48 Tests
EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-96Tests 96 Tests
EUR 692

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-48Tests 48 Tests
EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-96Tests 96 Tests
EUR 662

Epithelial Dissociation System 4 (Epithelial,Submandibular salivary), Mouse and Rat

4-20254 ea Ask for price

Heart Dissociation System 4 (Retinal pigment epithelial), Mouse and Rat

4-20294 ea Ask for price

Lung Dissociation System 4 (Alveolar type II), Mouse and Rat

4-20314 ea Ask for price

Reproductive Tissue Dissociation System 4 (Epithelial, vagina), Mouse and Rat

4-20414 ea Ask for price

RTN4IP1 Reticulon 4 Interacting Protein 1 Human Recombinant Protein

PROTQ8WWV3 Regular: 20ug
EUR 317
Description: RTN4IP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 379 amino acids (41-396 a.a.) and having a molecular mass of 41.4kDa. ;RTN4IP1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Individual Reaction Mix 4

G065-4 200 reactions
EUR 167

RTN4 Blocking Peptide

33R-3051 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTN4 antibody, catalog no. 70R-7139

RTN4 Blocking Peptide

33R-7833 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTN4 antibody, catalog no. 70R-7137

RTN4 Conjugated Antibody

C37191 100ul
EUR 397

RTN4 / NOGO Antibody

abx237524-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RTN4 / NOGO Antibody

abx237525-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

RTN4 cloning plasmid

CSB-CL878853HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 600
  • Sequence: atggacggtcagaagaaaaattggaaggacaaggttgttgacctcctgtactggagagacattaagaagactggagtggtgtttggtgccagcctattcctgctgctttcattgacagtattcagcattgtgagcgtaacagcctacattgccttggccctgctctctgtgaccat
  • Show more
Description: A cloning plasmid for the RTN4 gene.

RTN4 cloning plasmid

CSB-CL878853HU2-10ug 10ug
EUR 398
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1032
  • Sequence: atggaagacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagaggaagcccgccgccgggctgtccgcggccccagtgcccaccgcccctgccgccggcgcgcccctgatggacttcggaaatgacttcgtgccgccgg
  • Show more
Description: A cloning plasmid for the RTN4 gene.

RTN4 cloning plasmid

CSB-CL878853HU3-10ug 10ug
EUR 423
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1122
  • Sequence: atggaagacctggaccagtctcctctggtctcgtcctcggacagcccaccccggccgcagcccgcgttcaagtaccagttcgtgagggagcccgaggacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagcggaagc
  • Show more
Description: A cloning plasmid for the RTN4 gene.

RTN4 Rabbit pAb

A3114-100ul 100 ul
EUR 308

RTN4 Rabbit pAb

A3114-200ul 200 ul
EUR 459

RTN4 Rabbit pAb

A3114-20ul 20 ul Ask for price

RTN4 Rabbit pAb

A3114-50ul 50 ul
EUR 223

RTN4 Rabbit pAb

A19436-100ul 100 ul Ask for price

RTN4 Rabbit pAb

A19436-200ul 200 ul Ask for price

RTN4 Rabbit pAb

A19436-20ul 20 ul Ask for price

RTN4 Rabbit pAb

A19436-50ul 50 ul
EUR 308

RTN4 Rabbit pAb

A1752-100ul 100 ul
EUR 308

RTN4 Rabbit pAb

A1752-200ul 200 ul
EUR 459

RTN4 Rabbit pAb

A1752-20ul 20 ul
EUR 183

RTN4 Rabbit pAb

A1752-50ul 50 ul
EUR 223


PVT13995 2 ug
EUR 391

Anti-RTN4 antibody

STJ11100630 50 µl
EUR 287
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.

Anti-RTN4 antibody

STJ27689 100 µl
EUR 277
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.

Anti-RTN4 antibody

STJ119612 100 µl
EUR 277
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.

Anti-RTN4 Antibody

STJ501942 100 µg
EUR 476

Adrenal Dissociation System 4 (Heart, Adrenal chromaffin, Paraneurons), Mouse and Rat

4-20204 ea Ask for price

Kidney Dissociation System 4 (Inner medullary duct,Papillae), Mouse and Rat

4-29294 ea Ask for price

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

pLenti-CLDN1 shRNA-4 Plasmid

PVTBAV04867-4 2 ug
EUR 356

Feline IL-4 Recombinant Protein

R00230-4 5ug/vial
EUR 259
Description: IL-4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation, and the differentiation of CD4+ T-cells into Th2 cells. It is a key regulator in humoral and adaptive immunity. Feline IL-4 Recombinant Protein is purified interleukin-4 produced in yeast.

Rtn4 sgRNA CRISPR Lentivector set (Rat)

K7620701 3 x 1.0 ug
EUR 339

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Tumor Dissociation System 4 (Epithelial tumor,Neoplastic, Tumor, islet), Mouse and Rat

4-20484 ea Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Reticulon 1A/B antibody

10R-8106 100 ug
EUR 446
Description: Mouse monoclonal Reticulon 1A/B antibody

Reticulon 1A/B antibody

10R-8107 100 ug
EUR 435
Description: Mouse monoclonal Reticulon 1A/B antibody

Reticulon 3 (RTN3) Antibody

abx016053-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Reticulon 2 (RTN2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Reticulon 1 (RTN1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 2 (RTN2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 3 (RTN3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 1 (RTN1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Reticulon 1 (RTN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Reticulon 3 (RTN3) Antibody

abx011490-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Reticulon 2 (RTN2) Antibody

abx029573-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Reticulon 2 (RTN2) Antibody

abx029573-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Reticulon 2 (RTN2) Antibody

abx237522-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Reticulon 3 (RTN3) Antibody

abx237523-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Reticulon 1 (RTN1)

  • EUR 463.78
  • EUR 227.00
  • EUR 1464.16
  • EUR 554.72
  • EUR 1009.44
  • EUR 373.00
  • EUR 3510.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16799
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Reticulon 1 expressed in: E.coli

Recombinant Reticulon 1 (RTN1)

  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8K0T0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Reticulon 1 expressed in: E.coli

Anti-Reticulon 2 (6A11)

YF-MA15288 100 ug
EUR 363
Description: Mouse monoclonal to Reticulon 2


6780-4 1/pk
EUR 798
Description: Lab Equipment; Shakers & Mixers

Mouse FibrOut 4, for brain, neural

4-20507 1 ml Ask for price

Mouse FibrOut 4, for brain, neural

4-20508 5 x 1 ml Ask for price

Human FibrOut 4, for brain, neural

4-21552 1 ml Ask for price

Human FibrOut 4, for brain, neural

4-21553 5 x 1 ml Ask for price

Recombinant Human 4-1BB Receptor Protein

PROTQ07011-4 20ug
EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

Recombinant Human PF-4 (CXCL4) Protein

PROTP02776-4 20ug
EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

Bone Dissociation System 4 (Osteoblasts), Adult Mouse

4-20214 ea Ask for price

Pituitary Dissociation System 4 (Pituitary), Adult mouse

4-20404 ea Ask for price

IL-4 ELISA Kit| Rat Interleukin-4 ELISA Kit

EF017038 96 Tests
EUR 689

AQP-4 ELISA Kit| Rat Aquaporin-4 ELISA Kit

EF017200 96 Tests
EUR 689

NT-4 ELISA Kit| Rat Neurotrophin 4 ELISA Kit

EF017923 96 Tests
EUR 689

4-HNE ELISA Kit| Rat 4-Hydroxynonenal ELISA Kit

EF018187 96 Tests
EUR 689

PRL (Prolactin) ELISA test

4 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PRL (Prolactin)

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Mouse RTN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RTN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti- RTN4/NOGO antibody

FNab07524 100µg
EUR 548.75
  • Immunogen: reticulon 4
  • Uniprot ID: Q9NQC3
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against RTN4/NOGO

anti- RTN4/NOGO antibody

FNab07525 100µg
EUR 585
  • Immunogen: reticulon 4
  • Uniprot ID: Q9NQC3
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against RTN4/NOGO

Anti-RTN4/NOGO antibody

PAab07524 100 ug
EUR 386

Anti-RTN4/NOGO antibody

PAab07525 100 ug
EUR 412

Anti-RTN4 Antibody (Biotin)

STJ501943 100 µg
EUR 586

Anti-RTN4 Antibody (FITC)

STJ501944 100 µg
EUR 586

Rtn4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7620702 1.0 ug DNA
EUR 154

Rtn4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7620703 1.0 ug DNA
EUR 154

Rtn4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7620704 1.0 ug DNA
EUR 154

RTN4 Protein Vector (Rat) (pPB-C-His)

PV302982 500 ng
EUR 1191

RTN4 Protein Vector (Rat) (pPB-N-His)

PV302983 500 ng
EUR 1191

RTN4 Protein Vector (Rat) (pPM-C-HA)

PV302984 500 ng
EUR 1191

RTN4 Protein Vector (Rat) (pPM-C-His)

PV302985 500 ng
EUR 1191

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Neural Dissociation System 4 (Cerebella neurons Dorsa horn neurons Neurons, sympathetic Precursor Spinal), Mouse and Rat

4-20354 ea Ask for price


6781-4 1/pk
EUR 798
Description: Lab Equipment; Shakers & Mixers


6782-4 1/pk
EUR 798
Description: Lab Equipment; Shakers & Mixers

Mammary Dissociation System 4 (Epithelial, Swiss 3T3), Mouse

4-20324 ea Ask for price

Rat Interleukin 4, IL-4 ELISA KIT

CSB-E04635r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 4, IL-4 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Interleukin 4, IL-4 ELISA KIT

  • EUR 500.00
  • EUR 3402.00
  • EUR 1820.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 4, IL-4 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Neurotrophin 4, NT-4 ELISA KIT

CSB-E04691r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neurotrophin 4, NT-4 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Neurotrophin 4, NT-4 ELISA KIT

  • EUR 678.00
  • EUR 4644.00
  • EUR 2467.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neurotrophin 4, NT-4 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

BMP-4/ Rat BMP- 4 ELISA Kit

ELA-E0014r 96 Tests
EUR 886

FGF-4/ Rat FGF- 4 ELISA Kit

ELA-E0034r 96 Tests
EUR 886


ELA-E0055r 96 Tests
EUR 886

Rat Interleukin- 4, IL- 4 ELISA Kit

ELA-E0077r 96 Tests
EUR 886

NT-4/ Rat NT- 4 ELISA Kit

ELA-E0107r 96 Tests
EUR 886


ELA-E0130r 96 Tests
EUR 886

PF-4/ Rat PF- 4 ELISA Kit

ELA-E0172r 96 Tests
EUR 886

CA72-4/ Rat CA72- 4 ELISA Kit

ELA-E0210r 96 Tests
EUR 886

MCP-4/ Rat MCP- 4 ELISA Kit

ELA-E0216r 96 Tests
EUR 886

MMP-4/ Rat MMP- 4 ELISA Kit

ELA-E0554r 96 Tests
EUR 886

AQP-4/ Rat AQP- 4 ELISA Kit

ELA-E0582r 96 Tests
EUR 886

ANG-4/ Rat ANG- 4 ELISA Kit

ELA-E0668r 96 Tests
EUR 886

RBP-4/ Rat RBP- 4 ELISA Kit

ELA-E0929r 96 Tests
EUR 886

REG-4/ Rat REG- 4 ELISA Kit

ELA-E1819r 96 Tests
EUR 886

Rat Neurotrophin 4,NT-4 ELISA KIT

CN-01592R1 96T
EUR 464

Rat Neurotrophin 4,NT-4 ELISA KIT

CN-01592R2 48T
EUR 313

Rat Interleukin 4,IL-4 ELISA KIT

CN-01598R1 96T
EUR 452

Rat Interleukin 4,IL-4 ELISA KIT

CN-01598R2 48T
EUR 302

Rat Angiopoietin 4,ANG-4 ELISA Kit

CN-01625R1 96T
EUR 447

Rat Angiopoietin 4,ANG-4 ELISA Kit

CN-01625R2 48T
EUR 296

Rat Aquaporin 4,AQP-4 ELISA Kit

CN-01882R1 96T
EUR 471

Rat RTN4(Reticulon 4) ELISA Kit