Rat RTN4(Reticulon 4) ELISA Kit
To Order Contact us: [email protected]
Human Reticulon 4 (RTN4) ELISA Kit |
RD-RTN4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Reticulon 4 (RTN4) ELISA Kit |
RD-RTN4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Reticulon 4 (RTN4) ELISA Kit |
abx255978-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Rat RTN4(Reticulon 4) ELISA Kit |
ER1312 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q9JK11
- Alias: RTN4
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml |
Rat Reticulon 4 (RTN4) CLIA Kit |
abx197645-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat RTN4 (Reticulon 4) |
E-EL-R1503 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant |
Reticulon 4 (RTN4) Antibody |
20-abx214961 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 (RTN4) Antibody |
20-abx178258 |
Abbexa |
|
|
|
Reticulon 4 (RTN4) Antibody |
20-abx115138 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 (RTN4) Antibody |
20-abx123018 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 (RTN4) Antibody |
20-abx174385 |
Abbexa |
|
|
|
Reticulon 4 (RTN4) Antibody |
20-abx241122 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 (RTN4) Antibody |
20-abx328394 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 (RTN4) Antibody |
abx002254-50ul |
Abbexa |
50 ul |
EUR 356 |
- Shipped within 5-10 working days.
|
Human Reticulon-4(RTN4) ELISA kit |
CSB-EL020572HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 (RTN4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Reticulon-4(RTN4) ELISA kit |
1-CSB-EL020572HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4(RTN4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Reticulon 4 (RTN4) ELISA Kit |
abx051861-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-10 working days.
|
Human Reticulon 4 (RTN4) ELISA Kit |
20-abx152955 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Reticulon 4 (RTN4) ELISA Kit |
abx253120-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human RTN4(Reticulon 4) ELISA Kit |
EH3732 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78.125-5000 pg/ml
- Uniprot ID: Q9NQC3
- Alias: RTN4/Reticulon-5/RTN-x/Neuroendocrine-specific protein C homolog/Neuroendocrine-specific protein(NSP)/Foocen/Neurite outgrowth inhibitor(Nogo protein)/
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml |
Mouse Reticulon 4 (RTN4) ELISA Kit |
abx353194-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Reticulon 4 ELISA Kit (RTN4) |
RK02217 |
Abclonal |
96 Tests |
EUR 521 |
Human Reticulon 4 (RTN4) ELISA Kit |
SEF994Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 (RTN4) ELISA Kit |
SEF994Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 (RTN4) ELISA Kit |
SEF994Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 (RTN4) ELISA Kit |
SEF994Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 (RTN4) ELISA Kit |
4-SEF994Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Reticulon 4 elisa. Alternative names of the recognized antigen: NSP
- ASY
- NOGO
- NSP-CL
- RTN-X
- Reticulon-5
- Foocen
- Neurite outgrowth inhibitor
- Neuroendocrine-specific protein
- Neuroendocrine-specific protein C homolog
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 (RTN4) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
CLIA kit for Rat RTN4 (Reticulon 4) |
E-CL-R0748 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's RTN4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4 . Standards or samples are added to the micro CLIA plate wells and combined with the sp
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human RTN4 (Reticulon 4) |
E-EL-H2535 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Mouse RTN4 (Reticulon 4) |
E-EL-M1350 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human RTN4 (Reticulon 4) |
ELK4140 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 (RTN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticulon 4 (RT
- Show more
|
Description: A sandwich ELISA kit for detection of Reticulon 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Reticulon-4 (RTN4) |
KTE60779-48T |
Abbkine |
48T |
EUR 332 |
- Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Reticulon-4 (RTN4) |
KTE60779-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Reticulon-4 (RTN4) |
KTE60779-96T |
Abbkine |
96T |
EUR 539 |
- Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Reticulon 4 (RTN4) CLIA Kit |
20-abx495073 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Reticulon 4 (RTN4) Protein |
20-abx654948 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
20-abx156874 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Reticulon- 4 receptor, Rtn4r ELISA KIT |
ELI-18409m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Reticulon- 4 receptor, RTN4R ELISA KIT |
ELI-29471h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
SEF991Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
SEF991Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
SEF991Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
SEF991Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
4-SEF991Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Reticulon 4 Receptor elisa. Alternative names of the recognized antigen: NGR
- NOGOR
- Nogo-66 Receptor
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 Receptor (RTN4R) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Recombinant human Reticulon-4 |
P1398 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q9NQC3
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Reticulon-4 |
RTN4 ELISA Kit (Rat) (OKEH07826) |
OKEH07826 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: a myelin protein that is a potent inhibitor of neurite growth [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.6pg/mL |
RTN4 ELISA Kit (Rat) (OKEI00899) |
OKEI00899 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Developmental neurite growth regulatory factor with a role as a negative regulator of axon-axon adhesion and growth, and as a facilitator of neurite branching. Regulates neurite fasciculation, branching and extension in the developing nervous system. Involved in down-regulation of growth, stabilization of wiring and restriction of plasticity in the adult CNS. Regulates the radial migration of cortical neurons via an RTN4R-LINGO1 containing receptor complex. Isoform 2 and isoform 3 inhibit BACE1 activity and amyloid precursor protein processing. Induces the formation and stabilization of endoplasmic reticulum (ER) tubules. Regulates membrane morphogenesis in the ER by promoting tubular ER production. Influences NE expansion, nuclear pore complex formation and proper localization of inner nuclear membrane proteins.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
ELISA kit for Human RTN4R (Reticulon 4 Receptor) |
ELK5164 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 Receptor (RTN4R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Retic
- Show more
|
Description: A sandwich ELISA kit for detection of Reticulon 4 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Reticulon-4 receptor (RTN4R) |
KTE60778-48T |
Abbkine |
48T |
EUR 332 |
- Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Reticulon-4 receptor (RTN4R) |
KTE60778-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Reticulon-4 receptor (RTN4R) |
KTE60778-96T |
Abbkine |
96T |
EUR 539 |
- Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Reticulon 4 Receptor (RTN4R) Antibody |
20-abx008053 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 Receptor (RTN4R) Antibody |
20-abx004484 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Reticulon 4 Receptor (RTN4R) Antibody |
20-abx115139 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 Receptor (RTN4R) Antibody |
20-abx241707 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 Receptor (RTN4R) Antibody |
20-abx321708 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Reticulon 4 Receptor (RTN4R) CLIA Kit |
20-abx495072 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse RTN4 ELISA Kit |
STJ150544 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of RTN4 in Mouse serum, plasma and other biological fluids |
Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit |
CSB-EL020576HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2 (RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit |
1-CSB-EL020576HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2(RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Reticulon- 4 receptor- like 2, Rtn4rl2 ELISA KIT |
ELI-15500m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Reticulon- 4 receptor- like 2, RTN4RL2 ELISA KIT |
ELI-30455h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Reticulon- 4 receptor- like 1, Rtn4rl1 ELISA KIT |
ELI-52476m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Reticulon- 4 receptor- like 1, RTN4RL1 ELISA KIT |
ELI-35842h |
Lifescience Market |
96 Tests |
EUR 824 |
Reticulon 4 Interacting Protein 1 Protein |
20-abx260853 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
RTN4 ELISA Kit (Human) (OKAN06179) |
OKAN06179 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL |
RTN4 ELISA Kit (Mouse) (OKCA01764) |
OKCA01764 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL |
RTN4 ELISA Kit (Human) (OKCD08873) |
OKCD08873 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: RTN4 belongs to the family of reticulons. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. RTN4 is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates.This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL |
RTN4 ELISA Kit (Human) (OKDD00514) |
OKDD00514 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.058 ng/mL |
Liver Dissociation System 4 (Hepatocytes, rat), Rat |
4-20304 |
CHI Scientific |
ea |
Ask for price |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody |
20-abx135939 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody |
abx122324-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody |
abx032462-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody |
abx032462-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody |
20-abx308457 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant human Reticulon-4 receptor-like 2 |
P1411 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q86UN3
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Reticulon-4 receptor-like 2 |
RTN4R Reticulon 4 Receptor Human Recombinant Protein |
PROTQ9BZR6 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: RTN4R produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 429 amino acids (27-447 a.a.) andhaving a molecular mass of 46.3kDa (Molecular size on SDS-PAGE will appear atapproximately 40-57 kDa). RTN4R is expressed with a 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques. |
Rat FibrOut 4, for brain, neural |
4-20533 |
CHI Scientific |
1 ml |
Ask for price |
Rat FibrOut 4, for brain, neural |
4-20534 |
CHI Scientific |
5 x 1 ml |
Ask for price |
Rat RTN4 shRNA Plasmid |
20-abx986849 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RTN3(Reticulon-3) ELISA Kit |
EH12024 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: O95197
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Reticulon 2 (RTN2) ELISA Kit |
abx382990-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Reticulon 3 (RTN3) ELISA Kit |
abx382991-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Thymus Dissociation System 4 (Epithelial), Adult rat |
4-20444 |
CHI Scientific |
ea |
Ask for price |
RTN4 antibody |
70R-20039 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RTN4 antibody |
RTN4 Antibody |
37191-100ul |
SAB |
100ul |
EUR 252 |
RTN4 Antibody |
1-CSB-PA003461 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
RTN4 Antibody |
1-CSB-PA054695 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:50-1:200 |
RTN4 Antibody |
1-CSB-PA931699 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200 |
RTN4 antibody |
70R-7137 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RTN4 antibody raised against the middle region of RTN4 |
RTN4 antibody |
70R-7139 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RTN4 antibody raised against the middle region of RTN4 |
RTN4 Antibody |
1-CSB-PA020572GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
RTN4 siRNA |
20-abx904743 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RTN4 siRNA |
20-abx932262 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RTN4 siRNA |
20-abx932263 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody |
abx122325-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody |
20-abx309988 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cartilage Dissociation System 4 (Chondrocytes), Mouse and Rat |
4-20234 |
CHI Scientific |
ea |
Ask for price |
Pancreas Dissociation System 4 (Islets), Mouse and Rat |
4-20374 |
CHI Scientific |
ea |
Ask for price |
Skin Dissociation System 4 (Keratinocytes), Mouse and Rat |
4-20434 |
CHI Scientific |
ea |
Ask for price |
Human RTN1 (Reticulon- 1) ELISA Kit (CUSTOM) |
ELI-29470h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse RTN1 (Reticulon- 1) ELISA Kit (CUSTOM) |
ELI-53344m |
Lifescience Market |
96 Tests |
EUR 865 |
IL-4 Interleukin 4 Human Recombinant Protein, Yeast |
PROTP05112-4 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques. |
Rtn4 ORF Vector (Rat) (pORF) |
ORF075746 |
ABM |
1.0 ug DNA |
EUR 506 |
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
Adipose/Fat Dissociation System 4 (Predipocytes), Mouse and Rat |
4-20194 |
CHI Scientific |
ea |
Ask for price |
Brain Dissociation System 4 (Endothelial, Microvessels), Mouse and Rat |
4-20224 |
CHI Scientific |
ea |
Ask for price |
Endothelial Dissociation System 4 (Endothelial,Cerebral), Mouse and Rat |
4-20244 |
CHI Scientific |
ea |
Ask for price |
Heart Dissociation System 4 (Myocytes,Ventricles), Mouse and Rat |
4-20274 |
CHI Scientific |
ea |
Ask for price |
Muscle Dissociation System 4 (Smooth muscle), Mouse and Rat |
4-20334 |
CHI Scientific |
ea |
Ask for price |
Parotid Dissociation System 4 (Parotid acinar), Mouse and Rat |
4-20394 |
CHI Scientific |
ea |
Ask for price |
Reticulon 1A antibody |
10R-8103 |
Fitzgerald |
100 ug |
EUR 467 |
Description: Mouse monoclonal Reticulon 1A antibody |
Reticulon 1A antibody |
10R-8104 |
Fitzgerald |
100 ug |
EUR 467 |
Description: Mouse monoclonal Reticulon 1A antibody |
Reticulon 1A antibody |
10R-8105 |
Fitzgerald |
100 ug |
EUR 467 |
Description: Mouse monoclonal Reticulon 1A antibody |
Reticulon 1C antibody |
10R-8108 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Mouse monoclonal Reticulon 1C antibody |
anti-Reticulon 2 |
YF-PA14468 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Reticulon 2 |
anti-Reticulon 2 |
YF-PA14469 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Reticulon 2 |
anti-Reticulon 2 |
YF-PA14470 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Reticulon 2 |
anti-Reticulon 2 |
YF-PA24640 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Reticulon 2 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
DLR-CA72-4-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
DLR-CA72-4-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RDR-CA72-4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RDR-CA72-4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RD-CA72-4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RD-CA72-4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Epithelial Dissociation System 4 (Epithelial,Submandibular salivary), Mouse and Rat |
4-20254 |
CHI Scientific |
ea |
Ask for price |
Heart Dissociation System 4 (Retinal pigment epithelial), Mouse and Rat |
4-20294 |
CHI Scientific |
ea |
Ask for price |
Lung Dissociation System 4 (Alveolar type II), Mouse and Rat |
4-20314 |
CHI Scientific |
ea |
Ask for price |
Reproductive Tissue Dissociation System 4 (Epithelial, vagina), Mouse and Rat |
4-20414 |
CHI Scientific |
ea |
Ask for price |
RTN4IP1 Reticulon 4 Interacting Protein 1 Human Recombinant Protein |
PROTQ8WWV3 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: RTN4IP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 379 amino acids (41-396 a.a.) and having a molecular mass of 41.4kDa. ;RTN4IP1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Individual Reaction Mix 4 |
G065-4 |
ABM |
200 reactions |
EUR 167 |
RTN4 Blocking Peptide |
33R-3051 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTN4 antibody, catalog no. 70R-7139 |
RTN4 Blocking Peptide |
33R-7833 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTN4 antibody, catalog no. 70R-7137 |
RTN4 Conjugated Antibody |
C37191 |
SAB |
100ul |
EUR 397 |
RTN4 / NOGO Antibody |
abx237524-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
RTN4 / NOGO Antibody |
abx237525-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
RTN4 cloning plasmid |
CSB-CL878853HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 600
- Sequence: atggacggtcagaagaaaaattggaaggacaaggttgttgacctcctgtactggagagacattaagaagactggagtggtgtttggtgccagcctattcctgctgctttcattgacagtattcagcattgtgagcgtaacagcctacattgccttggccctgctctctgtgaccat
- Show more
|
Description: A cloning plasmid for the RTN4 gene. |
RTN4 cloning plasmid |
CSB-CL878853HU2-10ug |
Cusabio |
10ug |
EUR 398 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1032
- Sequence: atggaagacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagaggaagcccgccgccgggctgtccgcggccccagtgcccaccgcccctgccgccggcgcgcccctgatggacttcggaaatgacttcgtgccgccgg
- Show more
|
Description: A cloning plasmid for the RTN4 gene. |
RTN4 cloning plasmid |
CSB-CL878853HU3-10ug |
Cusabio |
10ug |
EUR 423 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1122
- Sequence: atggaagacctggaccagtctcctctggtctcgtcctcggacagcccaccccggccgcagcccgcgttcaagtaccagttcgtgagggagcccgaggacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagcggaagc
- Show more
|
Description: A cloning plasmid for the RTN4 gene. |
RTN4 Rabbit pAb |
A3114-100ul |
Abclonal |
100 ul |
EUR 308 |
RTN4 Rabbit pAb |
A3114-200ul |
Abclonal |
200 ul |
EUR 459 |
RTN4 Rabbit pAb |
A3114-20ul |
Abclonal |
20 ul |
Ask for price |
RTN4 Rabbit pAb |
A3114-50ul |
Abclonal |
50 ul |
EUR 223 |
RTN4 Rabbit pAb |
A19436-100ul |
Abclonal |
100 ul |
Ask for price |
RTN4 Rabbit pAb |
A19436-200ul |
Abclonal |
200 ul |
Ask for price |
RTN4 Rabbit pAb |
A19436-20ul |
Abclonal |
20 ul |
Ask for price |
RTN4 Rabbit pAb |
A19436-50ul |
Abclonal |
50 ul |
EUR 308 |
RTN4 Rabbit pAb |
A1752-100ul |
Abclonal |
100 ul |
EUR 308 |
RTN4 Rabbit pAb |
A1752-200ul |
Abclonal |
200 ul |
EUR 459 |
RTN4 Rabbit pAb |
A1752-20ul |
Abclonal |
20 ul |
EUR 183 |
RTN4 Rabbit pAb |
A1752-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-RTN4 antibody |
STJ11100630 |
St John's Laboratory |
50 µl |
EUR 287 |
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. |
Anti-RTN4 antibody |
STJ27689 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. |
Anti-RTN4 antibody |
STJ119612 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. |
Adrenal Dissociation System 4 (Heart, Adrenal chromaffin, Paraneurons), Mouse and Rat |
4-20204 |
CHI Scientific |
ea |
Ask for price |
Kidney Dissociation System 4 (Inner medullary duct,Papillae), Mouse and Rat |
4-29294 |
CHI Scientific |
ea |
Ask for price |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Feline IL-4 Recombinant Protein |
R00230-4 |
BosterBio |
5ug/vial |
EUR 259 |
Description: IL-4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation, and the differentiation of CD4+ T-cells into Th2 cells. It is a key regulator in humoral and adaptive immunity. Feline IL-4 Recombinant Protein is purified interleukin-4 produced in yeast. |
Rtn4 sgRNA CRISPR Lentivector set (Rat) |
K7620701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Tumor Dissociation System 4 (Epithelial tumor,Neoplastic, Tumor, islet), Mouse and Rat |
4-20484 |
CHI Scientific |
ea |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Reticulon 1A/B antibody |
10R-8106 |
Fitzgerald |
100 ug |
EUR 446 |
Description: Mouse monoclonal Reticulon 1A/B antibody |
Reticulon 1A/B antibody |
10R-8107 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Mouse monoclonal Reticulon 1A/B antibody |
Reticulon 3 (RTN3) Antibody |
abx016053-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Reticulon 2 (RTN2) Antibody |
20-abx003017 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 1 (RTN1) Antibody |
20-abx115135 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 2 (RTN2) Antibody |
20-abx115136 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 3 (RTN3) Antibody |
20-abx115137 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 1 (RTN1) Antibody |
20-abx131391 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Reticulon 1 (RTN1) Antibody |
20-abx131392 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Reticulon 3 (RTN3) Antibody |
abx011490-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Reticulon 2 (RTN2) Antibody |
abx029573-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Reticulon 2 (RTN2) Antibody |
abx029573-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Reticulon 2 (RTN2) Antibody |
abx237522-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Reticulon 3 (RTN3) Antibody |
abx237523-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Recombinant Reticulon 1 (RTN1) |
4-RPC905Hu01 |
Cloud-Clone |
-
EUR 463.78
-
EUR 227.00
-
EUR 1464.16
-
EUR 554.72
-
EUR 1009.44
-
EUR 373.00
-
EUR 3510.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q16799
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 51.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Reticulon 1 expressed in: E.coli |
Recombinant Reticulon 1 (RTN1) |
4-RPC905Mu01 |
Cloud-Clone |
-
EUR 481.70
-
EUR 232.00
-
EUR 1531.36
-
EUR 577.12
-
EUR 1054.24
-
EUR 385.00
-
EUR 3678.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8K0T0
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 51.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Reticulon 1 expressed in: E.coli |
Anti-Reticulon 2 (6A11) |
YF-MA15288 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Reticulon 2 |
DIGITAL SHAKER FOR 4 MICROPLATES, 120V |
6780-4 |
CORNING |
1/pk |
EUR 798 |
Description: Lab Equipment; Shakers & Mixers |
Mouse FibrOut 4, for brain, neural |
4-20507 |
CHI Scientific |
1 ml |
Ask for price |
Mouse FibrOut 4, for brain, neural |
4-20508 |
CHI Scientific |
5 x 1 ml |
Ask for price |
Human FibrOut 4, for brain, neural |
4-21552 |
CHI Scientific |
1 ml |
Ask for price |
Human FibrOut 4, for brain, neural |
4-21553 |
CHI Scientific |
5 x 1 ml |
Ask for price |
Recombinant Human 4-1BB Receptor Protein |
PROTQ07011-4 |
BosterBio |
20ug |
EUR 317 |
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor. |
Recombinant Human PF-4 (CXCL4) Protein |
PROTP02776-4 |
BosterBio |
20ug |
EUR 317 |
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines. |
Bone Dissociation System 4 (Osteoblasts), Adult Mouse |
4-20214 |
CHI Scientific |
ea |
Ask for price |
Pituitary Dissociation System 4 (Pituitary), Adult mouse |
4-20404 |
CHI Scientific |
ea |
Ask for price |
4-HNE ELISA Kit| Rat 4-Hydroxynonenal ELISA Kit |
EF018187 |
Lifescience Market |
96 Tests |
EUR 689 |
PRL (Prolactin) ELISA test |
4 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of PRL (Prolactin) |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Mouse RTN4 shRNA Plasmid |
20-abx976669 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RTN4 shRNA Plasmid |
20-abx961351 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
anti- RTN4/NOGO antibody |
FNab07524 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: reticulon 4
- Uniprot ID: Q9NQC3
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against RTN4/NOGO |
anti- RTN4/NOGO antibody |
FNab07525 |
FN Test |
100µg |
EUR 585 |
- Immunogen: reticulon 4
- Uniprot ID: Q9NQC3
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against RTN4/NOGO |
Rtn4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7620702 |
ABM |
1.0 ug DNA |
EUR 154 |
Rtn4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7620703 |
ABM |
1.0 ug DNA |
EUR 154 |
Rtn4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7620704 |
ABM |
1.0 ug DNA |
EUR 154 |
RTN4 Protein Vector (Rat) (pPB-C-His) |
PV302982 |
ABM |
500 ng |
EUR 1191 |
RTN4 Protein Vector (Rat) (pPB-N-His) |
PV302983 |
ABM |
500 ng |
EUR 1191 |
RTN4 Protein Vector (Rat) (pPM-C-HA) |
PV302984 |
ABM |
500 ng |
EUR 1191 |
RTN4 Protein Vector (Rat) (pPM-C-His) |
PV302985 |
ABM |
500 ng |
EUR 1191 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Neural Dissociation System 4 (Cerebella neurons Dorsa horn neurons Neurons, sympathetic Precursor Spinal), Mouse and Rat |
4-20354 |
CHI Scientific |
ea |
Ask for price |
DIGITAL SHAKER FOR 4 MICROPLATES, 230V-EU PLUG |
6781-4 |
CORNING |
1/pk |
EUR 798 |
Description: Lab Equipment; Shakers & Mixers |
DIGITAL SHAKER FOR 4 MICROPLATES, 230V-UK PLUG |
6782-4 |
CORNING |
1/pk |
EUR 798 |
Description: Lab Equipment; Shakers & Mixers |
Mammary Dissociation System 4 (Epithelial, Swiss 3T3), Mouse |
4-20324 |
CHI Scientific |
ea |
Ask for price |
Rat Interleukin 4, IL-4 ELISA KIT |
CSB-E04635r-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 4, IL-4 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat Interleukin 4, IL-4 ELISA KIT |
1-CSB-E04635r |
Cusabio |
-
EUR 500.00
-
EUR 3402.00
-
EUR 1820.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 4, IL-4 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Neurotrophin 4, NT-4 ELISA KIT |
CSB-E04691r-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Neurotrophin 4, NT-4 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat Neurotrophin 4, NT-4 ELISA KIT |
1-CSB-E04691r |
Cusabio |
-
EUR 678.00
-
EUR 4644.00
-
EUR 2467.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Neurotrophin 4, NT-4 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Neurotrophin 4,NT-4 ELISA KIT |
CN-01592R1 |
ChemNorm |
96T |
EUR 464 |
Rat Neurotrophin 4,NT-4 ELISA KIT |
CN-01592R2 |
ChemNorm |
48T |
EUR 313 |
Rat Interleukin 4,IL-4 ELISA KIT |
CN-01598R1 |
ChemNorm |
96T |
EUR 452 |
Rat Interleukin 4,IL-4 ELISA KIT |
CN-01598R2 |
ChemNorm |
48T |
EUR 302 |
Rat Angiopoietin 4,ANG-4 ELISA Kit |
CN-01625R1 |
ChemNorm |
96T |
EUR 447 |
Rat Angiopoietin 4,ANG-4 ELISA Kit |
CN-01625R2 |
ChemNorm |
48T |
EUR 296 |
Rat Aquaporin 4,AQP-4 ELISA Kit |
CN-01882R1 |
ChemNorm |
96T |
EUR 471 |
Rat RTN4(Reticulon 4) ELISA Kit