Rat STOML2 ELISA kit

Rat STOML2 ELISA kit

To Order Contact us: [email protected]

STOML2 siRNA

20-abx905340
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STOML2 antibody

70R-20609 50 ul
EUR 435
Description: Rabbit polyclonal STOML2 antibody

STOML2 Antibody

39917-100ul 100ul
EUR 390

STOML2 antibody

70R-10371 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal STOML2 antibody

STOML2 siRNA

20-abx935507
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STOML2 siRNA

20-abx935508
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STOML2 Antibody

1-CSB-PA892131ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STOML2 Antibody

DF12010 200ul
EUR 304
Description: STOML2 antibody detects endogenous levels of STOML2.

STOML2 Antibody

1-CSB-PA022864GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

pOTB7-STOML2

PVT19033 2 ug
EUR 231

anti-STOML2

YF-PA18713 50 ug
EUR 363
Description: Mouse polyclonal to STOML2

anti-STOML2

YF-PA18714 100 ul
EUR 403
Description: Rabbit polyclonal to STOML2

anti-STOML2

YF-PA18715 100 ug
EUR 403
Description: Rabbit polyclonal to STOML2

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Stoml2 ORF Vector (Rat) (pORF)

ORF077172 1.0 ug DNA
EUR 506

Human Stomatin Like 2 (STOML2) ELISA Kit

abx383537-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

anti- STOML2 antibody

FNab08346 100µg
EUR 548.75
  • Immunogen: stomatin(EPB72)-like 2
  • Uniprot ID: Q9UJZ1
  • Gene ID: 30968
  • Research Area: cancer
Description: Antibody raised against STOML2

anti- STOML2 antibody

FNab08347 100µg
EUR 548.75
  • Recommended dilution: WB: 1:2000-1:10000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: stomatin(EPB72)-like 2
  • Uniprot ID: Q9UJZ1
  • Gene ID: 30968
  • Research Area: cancer
Description: Antibody raised against STOML2

STOML2 Rabbit pAb

A10398-100ul 100 ul
EUR 308

STOML2 Rabbit pAb

A10398-200ul 200 ul
EUR 459

STOML2 Rabbit pAb

A10398-20ul 20 ul
EUR 183

STOML2 Rabbit pAb

A10398-50ul 50 ul
EUR 223

STOML2 Rabbit pAb

A4688-100ul 100 ul
EUR 308

STOML2 Rabbit pAb

A4688-200ul 200 ul
EUR 459

STOML2 Rabbit pAb

A4688-20ul 20 ul Ask for price

STOML2 Rabbit pAb

A4688-50ul 50 ul Ask for price

STOML2 Blocking Peptide

33R-9858 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STOML2 antibody, catalog no. 70R-10371

STOML2 Polyclonal Antibody

27419-100ul 100ul
EUR 252

STOML2 Polyclonal Antibody

27419-50ul 50ul
EUR 187

STOML2 Blocking Peptide

DF12010-BP 1mg
EUR 195

STOML2 cloning plasmid

CSB-CL892131HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc
  • Show more
Description: A cloning plasmid for the STOML2 gene.

STOML2 cloning plasmid

CSB-CL892131HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc
  • Show more
Description: A cloning plasmid for the STOML2 gene.

Anti-STOML2 antibody

PAab08346 100 ug
EUR 386

pOTB7-stoml2 Plasmid

PVTB00105 2 ug
EUR 356

pOTB7-STOML2 Plasmid

PVTB00250S 2 ug
EUR 356

pENTR223-STOML2 vector

PVT12019 2 ug
EUR 308

Anti-STOML2 antibody

STJ25737 100 µl
EUR 277

Anti-STOML2 antibody

STJ112434 100 µl
EUR 277

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Stoml2 sgRNA CRISPR Lentivector set (Rat)

K7189501 3 x 1.0 ug
EUR 339

Mouse Stomatin- like protein 2, Stoml2 ELISA KIT

ELI-53363m 96 Tests
EUR 865

Bovine Stomatin- like protein 2, STOML2 ELISA KIT

ELI-46244b 96 Tests
EUR 928

Human Stomatin- like protein 2, STOML2 ELISA KIT

ELI-39539h 96 Tests
EUR 824

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Polyclonal STOML2 Antibody (Center)

APR04539G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STOML2 (Center). This antibody is tested and proven to work in the following applications:

STOML2 Polyclonal Conjugated Antibody

C27419 100ul
EUR 397

Mouse STOML2 shRNA Plasmid

20-abx975687
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human STOML2 shRNA Plasmid

20-abx959362
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STOML2 Recombinant Protein (Human)

RP030469 100 ug Ask for price

STOML2 Recombinant Protein (Human)

RP030472 100 ug Ask for price

STOML2 Recombinant Protein (Mouse)

RP176132 100 ug Ask for price

pCMV-SPORT6-Stoml2-m

PVT18858 2 ug
EUR 231

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7189502 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7189503 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7189504 1.0 ug DNA
EUR 154

STOML2 Protein Vector (Rat) (pPB-C-His)

PV308686 500 ng
EUR 603

STOML2 Protein Vector (Rat) (pPB-N-His)

PV308687 500 ng
EUR 603

STOML2 Protein Vector (Rat) (pPM-C-HA)

PV308688 500 ng
EUR 603

STOML2 Protein Vector (Rat) (pPM-C-His)

PV308689 500 ng
EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Stomatin Like 2 (STOML2) Antibody

20-abx126669
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx036120-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

20-abx003539
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx031486-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx031486-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

20-abx321350
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx238346-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stomatin Like 2 (STOML2) Antibody

abx238347-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stoml2 ORF Vector (Mouse) (pORF)

ORF058712 1.0 ug DNA
EUR 506

STOML2 ORF Vector (Human) (pORF)

ORF010157 1.0 ug DNA
EUR 95

STOML2 ORF Vector (Human) (pORF)

ORF010158 1.0 ug DNA
EUR 95

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV690319 1.0 ug DNA
EUR 682

STOML2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV690323 1.0 ug DNA
EUR 682

STOML2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV690324 1.0 ug DNA
EUR 682

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

STOML2 sgRNA CRISPR Lentivector set (Human)

K2305701 3 x 1.0 ug
EUR 339

Stoml2 sgRNA CRISPR Lentivector set (Mouse)

K4605401 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7189505 3 x 1.0 ug
EUR 376

STOML2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2305702 1.0 ug DNA
EUR 154

STOML2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2305703 1.0 ug DNA
EUR 154

STOML2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2305704 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4605402 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4605403 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4605404 1.0 ug DNA
EUR 154

STOML2 Protein Vector (Human) (pPB-C-His)

PV040625 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPB-N-His)

PV040626 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPM-C-HA)

PV040627 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPM-C-His)

PV040628 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPB-C-His)

PV040629 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPB-N-His)

PV040630 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPM-C-HA)

PV040631 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPM-C-His)

PV040632 500 ng
EUR 329

STOML2 Protein Vector (Mouse) (pPB-C-His)

PV234846 500 ng
EUR 603

STOML2 Protein Vector (Mouse) (pPB-N-His)

PV234847 500 ng
EUR 603

STOML2 Protein Vector (Mouse) (pPM-C-HA)

PV234848 500 ng
EUR 603

STOML2 Protein Vector (Mouse) (pPM-C-His)

PV234849 500 ng
EUR 603

Stoml2 3'UTR GFP Stable Cell Line

TU169867 1.0 ml Ask for price

Stoml2 3'UTR Luciferase Stable Cell Line

TU119867 1.0 ml Ask for price

STOML2 3'UTR GFP Stable Cell Line

TU074839 1.0 ml
EUR 1394

STOML2 3'UTR Luciferase Stable Cell Line

TU024839 1.0 ml
EUR 1394

Stoml2 3'UTR Luciferase Stable Cell Line

TU221333 1.0 ml Ask for price

Stoml2 3'UTR GFP Stable Cell Line

TU271333 1.0 ml Ask for price

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV690320 1.0 ug DNA
EUR 682

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV690321 1.0 ug DNA
EUR 740

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV690322 1.0 ug DNA
EUR 740

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7189506 1.0 ug DNA
EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7189507 1.0 ug DNA
EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7189508 1.0 ug DNA
EUR 167

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV715539 1.0 ug DNA
EUR 316

STOML2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV715543 1.0 ug DNA
EUR 316

STOML2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV715544 1.0 ug DNA
EUR 316

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2305705 3 x 1.0 ug
EUR 376

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4605405 3 x 1.0 ug
EUR 376

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2305706 1.0 ug DNA
EUR 167

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2305707 1.0 ug DNA
EUR 167

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2305708 1.0 ug DNA
EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4605406 1.0 ug DNA
EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4605407 1.0 ug DNA
EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4605408 1.0 ug DNA
EUR 167

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV715540 1.0 ug DNA
EUR 316

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV715541 1.0 ug DNA
EUR 374

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV715542 1.0 ug DNA
EUR 374

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

/ Rat ELISA Kit

ELA-E0703r 96 Tests
EUR 886

/ Rat ELISA Kit

ELA-E1084r 96 Tests
EUR 886

TRF ELISA Kit| Rat Transferrin ELISA Kit

EF018096 96 Tests
EUR 689

TRX ELISA Kit| Rat Thioredoxin ELISA Kit

EF018097 96 Tests
EUR 689

TRY ELISA Kit| Rat Trypsin ELISA Kit

EF018099 96 Tests
EUR 689

TYR ELISA Kit| Rat Tyrosinase ELISA Kit

EF018105 96 Tests
EUR 689

VF ELISA Kit| Rat Visfatin ELISA Kit

EF018113 96 Tests
EUR 689

AD ELISA Kit| Rat Adropin ELISA Kit

EF018137 96 Tests
EUR 689

T ELISA Kit| Rat Testosterone ELISA Kit

EF018139 96 Tests
EUR 689

Ach ELISA Kit| Rat Acetylcholine ELISA Kit

EF018143 96 Tests
EUR 689

CFP ELISA Kit| Rat Properdin ELISA Kit

EF018144 96 Tests
EUR 689

BrdU ELISA Kit| Rat Bromodeoxyuridine ELISA Kit

EF018146 96 Tests
EUR 689

Estrone ELISA Kit| Rat Estrone ELISA Kit

EF018156 96 Tests
EUR 689

E2 ELISA Kit| Rat Estradiol ELISA Kit

EF018157 96 Tests
EUR 689

HCY ELISA Kit| Rat Homocysteine ELISA Kit

EF018158 96 Tests
EUR 689

GAGs ELISA Kit| Rat Glycosaminoglycan ELISA Kit

EF018159 96 Tests
EUR 689

DAG ELISA Kit| Rat Diacylglycerol ELISA Kit

EF018164 96 Tests
EUR 689

MTL5 ELISA Kit| Rat Tesmin ELISA Kit

EF018168 96 Tests
EUR 689

FATP4 ELISA Kit| Rat FATP4 ELISA Kit

EF018183 96 Tests
EUR 689

Hyp ELISA Kit| Rat Hydroxyproline ELISA Kit

EF018211 96 Tests
EUR 689

Adipolin ELISA Kit| Rat FAM132A ELISA Kit

EF018220 96 Tests
EUR 689

Calprotectin ELISA Kit| Rat Calprotectin ELISA Kit

EF018230 96 Tests
EUR 689

Ahi1 ELISA Kit| Rat Jouberin ELISA Kit

EF018267 96 Tests
EUR 689

Ahcy ELISA Kit| Rat Adenosylhomocysteinase ELISA Kit

EF018288 96 Tests
EUR 689

Afm ELISA Kit| Rat Afamin ELISA Kit

EF018303 96 Tests
EUR 689

Atrn ELISA Kit| Rat Attractin ELISA Kit

EF018356 96 Tests
EUR 689

Bsnd ELISA Kit| Rat Barttin ELISA Kit

EF018361 96 Tests
EUR 689

Bfsp1 ELISA Kit| Rat Filensin ELISA Kit

EF018367 96 Tests
EUR 689

Bscl2 ELISA Kit| Rat Seipin ELISA Kit

EF018368 96 Tests
EUR 689

Bgn ELISA Kit| Rat Biglycan ELISA Kit

EF018374 96 Tests
EUR 689

Rat STOML2 ELISA kit