Mouse MSTO1(Misato Homolog 1) ELISA Kit

Mouse MSTO1(Misato Homolog 1) ELISA Kit

To Order Contact us: [email protected]

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

RD-MSTO1-Mu-96Tests 96 Tests
EUR 802

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

RDR-MSTO1-Mu-48Tests 48 Tests
EUR 603

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

RDR-MSTO1-Mu-96Tests 96 Tests
EUR 840

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

20-abx154390
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

SES031Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

SES031Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

SES031Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

SES031Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

4-SES031Mu
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Misato Homolog 1 elisa. Alternative names of the recognized antigen: MST
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Misato Homolog 1 (MSTO1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Misato Homolog 1 (MSTO1) Antibody

20-abx129456
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Misato Homolog 1 (MSTO1) Antibody

20-abx177572
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Misato Homolog 1 (MSTO1)

4-RPS031Mu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q2YDW2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Misato Homolog 1 expressed in: E.coli

Mouse Misato Homolog 1 (MSTO1) Protein

20-abx167304
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Misato Homolog 1 (MSTO1) CLIA Kit

20-abx496242
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Misato Homolog 1(MSTO1)ELISA Kit

QY-E04795 96T
EUR 361

Mouse Protein misato homolog 1, Msto1 ELISA KIT

ELI-12984m 96 Tests
EUR 865

ELISA kit for Mouse MSTO1 (Misato Homolog 1)

ELK7988 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Misato Homolog 1 (MSTO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Misato Ho
  • Show more
Description: A sandwich ELISA kit for detection of Misato Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse)

4-PAS031Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1)

Protein Misato Homolog 1 (MSTO1) Antibody

abx146319-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Misato Homolog 1 (MSTO1) Antibody

20-abx301709
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bovine Protein misato homolog 1, MSTO1 ELISA KIT

ELI-20864b 96 Tests
EUR 928

Human Protein misato homolog 1, MSTO1 ELISA KIT

ELI-23224h 96 Tests
EUR 824

Human Protein misato homolog 1 (MSTO1) ELISA Kit

abx385159-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Msto1 ELISA Kit| Mouse Protein misato homolog 1 ELISA Kit

EF015532 96 Tests
EUR 689

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), APC

4-PAS031Mu01-APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with APC.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), Biotinylated

4-PAS031Mu01-Biotin
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with Biotin.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), Cy3

4-PAS031Mu01-Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with Cy3.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), FITC

4-PAS031Mu01-FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with FITC.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), HRP

4-PAS031Mu01-HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with HRP.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), PE

4-PAS031Mu01-PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with PE.

Protein Misato Homolog 1 (MSTO1) Antibody (HRP)

20-abx311515
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Misato Homolog 1 (MSTO1) Antibody (FITC)

20-abx311516
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Misato Homolog 1 (MSTO1) Antibody (Biotin)

20-abx311517
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MSTO1 ELISA Kit| Bovine Protein misato homolog 1 ELISA Kit

EF011608 96 Tests
EUR 689

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAS031Mu01-APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

MSTO1 ELISA KIT|Human

EF005279 96 Tests
EUR 689

Mouse MSTO1 shRNA Plasmid

20-abx981703
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MSTO1 Recombinant Protein (Mouse)

RP151880 100 ug Ask for price

MSTO1 siRNA

20-abx924826
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSTO1 siRNA

20-abx924827
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSTO1 antibody

70R-8488 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MSTO1 antibody

MSTO1 antibody

22173-100ul 100ul
EUR 390

MSTO1 antibody

70R-12878 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal MSTO1 antibody

MSTO1 Antibody

1-CSB-PA880106LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSTO1. Recognizes MSTO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-MSTO1

YF-PA19583 50 ug
EUR 363
Description: Mouse polyclonal to MSTO1

Msto1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4214102 1.0 ug DNA
EUR 154

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Msto1 ORF Vector (Mouse) (pORF)

ORF050628 1.0 ug DNA
EUR 506

Mouse Notch Homolog 1 ELISA kit

E03N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Notch Homolog 1 ELISA kit

E03N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Notch Homolog 1 ELISA kit

E03N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MSTO1 Polyclonal Antibody

A59934 100 µg
EUR 570.55
Description: The best epigenetics products

MSTO1 Blocking Peptide

33R-10232 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MSTO1 antibody, catalog no. 70R-8488

MSTO1 cloning plasmid

CSB-CL880106HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1713
  • Sequence: atggcgggcggggcccgggaggtgctcacactgcagttgggacattttgccggtttcgtgggcgcgcactggtggaaccagcaggatgctgcgctgggccgagcgaccgattccaaggagcccccgggagagctgtgccccgacgtcctgtatcgtacgggccggacgctgcacg
  • Show more
Description: A cloning plasmid for the MSTO1 gene.

pENTR223-MSTO1 vector

PVT11773 2 ug
EUR 304

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Msto1 sgRNA CRISPR Lentivector set (Mouse)

K4214101 3 x 1.0 ug
EUR 339

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Mouse Roundabout homolog 1 (ROBO1) ELISA Kit

abx555892-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Dachshund Homolog 1 (DACH1) ELISA Kit

abx556123-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Frizzled Homolog 1 (FZD1) ELISA Kit

abx515256-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Crumbs homolog 1(CRB1) ELISA kit

E03C2038-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crumbs homolog 1(CRB1) ELISA kit

E03C2038-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crumbs homolog 1(CRB1) ELISA kit

E03C2038-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Achaete scute homolog 1 ELISA kit

E03A0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Achaete scute homolog 1 ELISA kit

E03A0079-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Achaete scute homolog 1 ELISA kit

E03A0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit

E03P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit

E03P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit

E03P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dab1/ Disabled homolog 1 ELISA Kit

E0377Mo 1 Kit
EUR 632

ELISA kit for Mouse Disabled homolog 1

EK3038 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Robo1/ Roundabout homolog 1 ELISA Kit

E1276Mo 1 Kit
EUR 632

Mouse Nanos homolog 1, Nanos1 ELISA KIT

ELI-22326m 96 Tests
EUR 865

Mouse Disabled homolog 1, Dab1 ELISA KIT

ELI-04119m 96 Tests
EUR 865

Mouse Dachshund homolog 1, Dach1 ELISA KIT

ELI-07865m 96 Tests
EUR 865

Mouse Teashirt homolog 1, Tshz1 ELISA KIT

ELI-51860m 96 Tests
EUR 865

Mouse Nitrilase homolog 1, Nit1 ELISA KIT

ELI-35327m 96 Tests
EUR 865

Mouse Pumilio homolog 1, Pum1 ELISA KIT

ELI-36786m 96 Tests
EUR 865

Mouse Crumbs homolog 1, Crb1 ELISA KIT

ELI-47518m 96 Tests
EUR 865

Mouse Pygopus homolog 1, Pygo1 ELISA KIT

ELI-30536m 96 Tests
EUR 865

Mouse Dapper homolog 1, Dact1 ELISA KIT

ELI-31901m 96 Tests
EUR 865

Mouse Roundabout homolog 1, Robo1 ELISA KIT

ELI-38645m 96 Tests
EUR 865

Mouse Dab1(Disabled homolog 1) ELISA Kit

EM0551 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: P97318
  • Alias: Dab1/DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit

20-abx153918
  • EUR 5640.00
  • EUR 3009.00
  • EUR 707.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

20-abx154688
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit

abx254020-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Nitrilase homolog 1 (NIT1) ELISA Kit

abx390062-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

DLR-Slit1-Mu-48T 48T
EUR 527
  • Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

DLR-Slit1-Mu-96T 96T
EUR 688
  • Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Mu-48T 48T
EUR 527
  • Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Mu-96T 96T
EUR 688
  • Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

RD-Slit1-Mu-48Tests 48 Tests
EUR 533

Mouse Slit Homolog 1 (Slit1) ELISA Kit

RD-Slit1-Mu-96Tests 96 Tests
EUR 740

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RDR-DAB1-Mu-48Tests 48 Tests
EUR 557

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RDR-DAB1-Mu-96Tests 96 Tests
EUR 774

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Mu-48Tests 48 Tests
EUR 533

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Mu-96Tests 96 Tests
EUR 740

Mouse Slit Homolog 1 (Slit1) ELISA Kit

RDR-Slit1-Mu-48Tests 48 Tests
EUR 557

Mouse Slit Homolog 1 (Slit1) ELISA Kit

RDR-Slit1-Mu-96Tests 96 Tests
EUR 774

Mouse Disabled Homolog 1(DAB1)ELISA Kit

QY-E20475 96T
EUR 361

Mouse Frizzled Homolog 1(FZD1)ELISA Kit

QY-E20616 96T
EUR 361

Mouse Slit Homolog 1 (Slit1) ELISA Kit

SED354Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

SED354Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

SED354Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

SED354Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

4-SED354Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Slit Homolog 1 elisa. Alternative names of the recognized antigen: MEGF4
  • SLIL1
  • SLIT3
  • Multiple epidermal growth factor-like domains protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Slit Homolog 1 (Slit1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Dach1 ELISA Kit| Mouse Dachshund homolog 1 ELISA Kit

EF014622 96 Tests
EUR 689

Nit1 ELISA Kit| Mouse Nitrilase homolog 1 ELISA Kit

EF015701 96 Tests
EUR 689

Dab1 ELISA Kit| Mouse Disabled homolog 1 ELISA Kit

EF013178 96 Tests
EUR 689

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human MSTO1 shRNA Plasmid

20-abx960510
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MSTO1 Antibody, HRP conjugated

1-CSB-PA880106LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSTO1. Recognizes MSTO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MSTO1 Antibody, FITC conjugated

1-CSB-PA880106LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSTO1. Recognizes MSTO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MSTO1 Antibody, Biotin conjugated

1-CSB-PA880106LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSTO1. Recognizes MSTO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MSTO1 Recombinant Protein (Human)

RP020197 100 ug Ask for price

MSTO1 Recombinant Protein (Rat)

RP212594 100 ug Ask for price

pECMV-3-FLAG-MSTO1

PVT14061 2 ug
EUR 599

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Msto1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6362102 1.0 ug DNA
EUR 154

MSTO1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1351202 1.0 ug DNA
EUR 154

Mouse Protein sel- 1 homolog 1, Sel1l ELISA KIT

ELI-42374m 96 Tests
EUR 865

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EMI2200-1 96 Well Plate
EUR 477

Msto1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4214103 1.0 ug DNA
EUR 154

Msto1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4214104 1.0 ug DNA
EUR 154

MSTO1 Protein Vector (Mouse) (pPB-C-His)

PV202510 500 ng
EUR 603

MSTO1 Protein Vector (Mouse) (pPB-N-His)

PV202511 500 ng
EUR 603

MSTO1 Protein Vector (Mouse) (pPM-C-HA)

PV202512 500 ng
EUR 603

MSTO1 Protein Vector (Mouse) (pPM-C-His)

PV202513 500 ng
EUR 603

Mouse Snail Homolog ELISA kit

E03S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Snail Homolog ELISA kit

E03S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Snail Homolog ELISA kit

E03S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Disp1 ELISA Kit| Mouse Protein dispatched homolog 1 ELISA Kit

EF014711 96 Tests
EUR 689

Jagn1 ELISA Kit| Mouse Protein jagunal homolog 1 ELISA Kit

EF015301 96 Tests
EUR 689

Ptch1 ELISA Kit| Mouse Protein patched homolog 1 ELISA Kit

EF015804 96 Tests
EUR 689

Sav1 ELISA Kit| Mouse Protein salvador homolog 1 ELISA Kit

EF016133 96 Tests
EUR 689

Fermt1 ELISA Kit| Mouse Fermitin family homolog 1 ELISA Kit

EF013237 96 Tests
EUR 689

Ascl1 ELISA Kit| Mouse Achaete-scute homolog 1 ELISA Kit

EF014112 96 Tests
EUR 689

Cby1 ELISA Kit| Mouse Protein chibby homolog 1 ELISA Kit

EF014473 96 Tests
EUR 689

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Mouse Achaete-Scute Homolog 1 (ASCL1) ELISA Kit

abx555606-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Protein Atonal Homolog 1 (ATOH1) ELISA Kit

abx512375-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Protein delta homolog 1 (DLK1) ELISA Kit

abx574066-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Dlk1/ Protein delta homolog 1 ELISA Kit

E0406Mo 1 Kit
EUR 571

Mouse seminal plasma protein homolog 1 ELISA kit

E03B0856-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse seminal plasma protein homolog 1 ELISA kit

E03B0856-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse seminal plasma protein homolog 1 ELISA kit

E03B0856-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chromobox protein homolog 1(CBX1) ELISA kit

E03C1420-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chromobox protein homolog 1(CBX1) ELISA kit

E03C1420-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chromobox protein homolog 1(CBX1) ELISA kit

E03C1420-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit

E03S0269-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit

E03S0269-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit

E03S0269-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Fermt1/ Fermitin family homolog 1 ELISA Kit

E0522Mo 1 Kit
EUR 632

ELISA kit for Mouse Fermitin family homolog 1

EK3461 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Fermitin family homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Chromobox protein homolog 1, Cbx1 ELISA KIT

ELI-10762m 96 Tests
EUR 865

Mouse Protein Hook homolog 1, Hook1 ELISA KIT

ELI-13075m 96 Tests
EUR 865

Mouse Slit homolog 1 protein, Slit1 ELISA KIT

ELI-18718m 96 Tests
EUR 865

Mouse Single- minded homolog 1, Sim1 ELISA KIT

ELI-19165m 96 Tests
EUR 865

Mouse Mitochondrial carrier homolog 1, Mtch1 ELISA KIT

ELI-19361m 96 Tests
EUR 865

Mouse Protein jagunal homolog 1, Jagn1 ELISA KIT

ELI-19920m 96 Tests
EUR 865

Mouse Protein NipSnap homolog 1, Nipsnap1 ELISA KIT

ELI-20721m 96 Tests
EUR 865

Mouse Notchless protein homolog 1, Nle1 ELISA KIT

ELI-23641m 96 Tests
EUR 865

Mouse Achaete- scute homolog 1, Ascl1 ELISA KIT

ELI-23996m 96 Tests
EUR 865

Mouse Protein angel homolog 1, Angel1 ELISA KIT

ELI-24203m 96 Tests
EUR 865

Mouse Protein chibby homolog 1, Cby1 ELISA KIT

ELI-24880m 96 Tests
EUR 865

Mouse Protein diaphanous homolog 1, Diaph1 ELISA KIT

ELI-26053m 96 Tests
EUR 865

Mouse Protein flightless- 1 homolog, Flii ELISA KIT

ELI-26738m 96 Tests
EUR 865

Mouse Protein delta homolog 1, Dlk1 ELISA KIT

ELI-03464m 96 Tests
EUR 865

Mouse Fermitin family homolog 1, Fermt1 ELISA KIT

ELI-04835m 96 Tests
EUR 865

Mouse Protein tweety homolog 1, Ttyh1 ELISA KIT

ELI-17045m 96 Tests
EUR 865

Mouse Homer protein homolog 1, Homer1 ELISA KIT

ELI-07972m 96 Tests
EUR 865

Mouse Protein canopy homolog 1, Cnpy1 ELISA KIT

ELI-09145m 96 Tests
EUR 865

Mouse Disks large homolog 1, Dlg1 ELISA KIT

ELI-09200m 96 Tests
EUR 865

Mouse Protein dispatched homolog 1, Disp1 ELISA KIT

ELI-26868m 96 Tests
EUR 865

ELISA kit for Mouse Slit1 (Slit Homolog 1)

ELK6408 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Slit Homolog 1 (Slit1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Slit Homolo
  • Show more
Description: A sandwich ELISA kit for detection of Slit Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Protein sprouty homolog 1, Spry1 ELISA KIT

ELI-53435m 96 Tests
EUR 865

Mouse Protein PAT1 homolog 1, Patl1 ELISA KIT

ELI-35757m 96 Tests
EUR 865

Mouse Protein salvador homolog 1, Sav1 ELISA KIT

ELI-35944m 96 Tests
EUR 865

Mouse TRIB1 (Tribbles homolog 1) ELISA Kit (CUSTOM)

ELI-36571m 96 Tests
EUR 865

Mouse Protein patched homolog 1, Ptch1 ELISA KIT

ELI-36765m 96 Tests
EUR 865

Mouse RNA exonuclease 1 homolog, Rexo1 ELISA KIT

ELI-42846m 96 Tests
EUR 865

Mouse Protein zer- 1 homolog, Zer1 ELISA KIT

ELI-44277m 96 Tests
EUR 865

Mouse Protein DDI1 homolog 1, Ddi1 ELISA KIT

ELI-46738m 96 Tests
EUR 865

Mouse Protein Smaug homolog 1, Samd4a ELISA KIT

ELI-29113m 96 Tests
EUR 865

Mouse Protein spinster homolog 1, Spns1 ELISA KIT

ELI-29123m 96 Tests
EUR 865

Mouse Protein spire homolog 1, Spire1 ELISA KIT

ELI-30168m 96 Tests
EUR 865

Mouse Eyes absent homolog 1, Eya1 ELISA KIT

ELI-31369m 96 Tests
EUR 865

Mouse Egl nine homolog 1, Egln1 ELISA KIT

ELI-32638m 96 Tests
EUR 865

Mouse Protein slowmo homolog 1, Slmo1 ELISA KIT

ELI-41004m 96 Tests
EUR 865

Mouse Protein asteroid homolog 1, Aste1 ELISA KIT

ELI-49583m 96 Tests
EUR 865

Mouse Fermt1(Fermitin family homolog 1) ELISA Kit

EM0617 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P59113
  • Alias: Fermt1/Fermitin family homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Mouse delta Like 1 Homolog (dLK1) ELISA Kit

20-abx153909
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit

abx254902-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Fermitin Family Homolog 1 (FERMT1) ELISA Kit

abx254968-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Protein Chibby Homolog 1 (CBY1) ELISA Kit

abx388848-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein dispatched homolog 1 (DISP1) ELISA Kit

abx389081-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein jagunal homolog 1 (JAGN1) ELISA Kit

abx389667-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Mitochondrial carrier homolog 1 (MTCH1) ELISA Kit

abx389898-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein patched homolog 1 (PTCH1) ELISA Kit

abx390165-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein salvador homolog 1 (SAV1) ELISA Kit

abx390491-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Delta Like 1 Homolog (dLK1) ELISA Kit

DLR-dLK1-Mu-48T 48T
EUR 566
  • Should the Mouse Delta Like 1 Homolog (dLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Delta Like 1 Homolog (dLK1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Delta Like 1 Homolog (dLK1) ELISA Kit

DLR-dLK1-Mu-96T 96T
EUR 741
  • Should the Mouse Delta Like 1 Homolog (dLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Delta Like 1 Homolog (dLK1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

DLR-EGLN1-Mu-48T 48T
EUR 566
  • Should the Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

DLR-EGLN1-Mu-96T 96T
EUR 741
  • Should the Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Protein delta homolog 1(DLK1) ELISA kit

CSB-EL006945MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein delta homolog 1 (DLK1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Protein delta homolog 1(DLK1) ELISA kit

1-CSB-EL006945MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein delta homolog 1(DLK1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Mouse Dapper homolog 1 (DACT1)

KTE71341-48T 48T
EUR 332
  • The protein encoded by DACT1 belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dapper homolog 1 (DACT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dapper homolog 1 (DACT1)

KTE71341-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by DACT1 belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dapper homolog 1 (DACT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dapper homolog 1 (DACT1)

KTE71341-96T 96T
EUR 539
  • The protein encoded by DACT1 belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dapper homolog 1 (DACT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dachshund homolog 1 (DACH1)

KTE71343-48T 48T
EUR 332
  • DACH1 encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Dros
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dachshund homolog 1 (DACH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dachshund homolog 1 (DACH1)

KTE71343-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DACH1 encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Dros
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dachshund homolog 1 (DACH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dachshund homolog 1 (DACH1)

KTE71343-96T 96T
EUR 539
  • DACH1 encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Dros
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dachshund homolog 1 (DACH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Pygopus homolog 1 (PYGO1)

KTE70589-48T 48T
EUR 332
  • WNT signaling controls many fundamental processes during animal development. WNT transduction is mediated by the association of beta-catenin with nuclear TCF DNA-binding factors.Lgs encodes the homolog of human BCL9, and the authors provided genetic
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Pygopus homolog 1 (PYGO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Pygopus homolog 1 (PYGO1)

KTE70589-5platesof96wells 5 plates of 96 wells
EUR 2115
  • WNT signaling controls many fundamental processes during animal development. WNT transduction is mediated by the association of beta-catenin with nuclear TCF DNA-binding factors.Lgs encodes the homolog of human BCL9, and the authors provided genetic
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Pygopus homolog 1 (PYGO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Pygopus homolog 1 (PYGO1)

KTE70589-96T 96T
EUR 539
  • WNT signaling controls many fundamental processes during animal development. WNT transduction is mediated by the association of beta-catenin with nuclear TCF DNA-binding factors.Lgs encodes the homolog of human BCL9, and the authors provided genetic
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Pygopus homolog 1 (PYGO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Delta Like 1 Homolog ELISA Kit (dLK1)

RK02751 96 Tests
EUR 521

Mouse Delta Like 1 Homolog (dLK1) ELISA Kit

RDR-dLK1-Mu-48Tests 48 Tests
EUR 603

Mouse Delta Like 1 Homolog (dLK1) ELISA Kit

RDR-dLK1-Mu-96Tests 96 Tests
EUR 840

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RDR-EGLN1-Mu-48Tests 48 Tests
EUR 603

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RDR-EGLN1-Mu-96Tests 96 Tests
EUR 840

Mouse Delta Like 1 Homolog (dLK1) ELISA Kit

RD-dLK1-Mu-48Tests 48 Tests
EUR 577

Mouse Delta Like 1 Homolog (dLK1) ELISA Kit

RD-dLK1-Mu-96Tests 96 Tests
EUR 802

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RD-EGLN1-Mu-48Tests 48 Tests
EUR 577

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RD-EGLN1-Mu-96Tests 96 Tests
EUR 802

Mouse Egl Nine Homolog 1(EGLN1)ELISA Kit

QY-E20507 96T
EUR 361

Mouse MSTO1(Misato Homolog 1) ELISA Kit