Mouse MSTO1(Misato Homolog 1) ELISA Kit
To Order Contact us: [email protected]
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
RDR-MSTO1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
RD-MSTO1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
RD-MSTO1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
20-abx154390 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
SES031Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
SES031Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
SES031Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
SES031Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
4-SES031Mu |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Misato Homolog 1 elisa. Alternative names of the recognized antigen: MST
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Misato Homolog 1 (MSTO1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Misato Homolog 1 (MSTO1) Antibody |
20-abx177572 |
Abbexa |
|
|
|
Misato Homolog 1 (MSTO1) Antibody |
20-abx129456 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Recombinant Misato Homolog 1 (MSTO1) |
4-RPS031Mu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q2YDW2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 42.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Misato Homolog 1 expressed in: E.coli |
Mouse Misato Homolog 1 (MSTO1) Protein |
20-abx167304 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Misato Homolog 1 (MSTO1) CLIA Kit |
20-abx496242 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Protein misato homolog 1, Msto1 ELISA KIT |
ELI-12984m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Mouse MSTO1 (Misato Homolog 1) |
ELK7988 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Misato Homolog 1 (MSTO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Misato Ho
- Show more
|
Description: A sandwich ELISA kit for detection of Misato Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse) |
4-PAS031Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1) |
Protein Misato Homolog 1 (MSTO1) Antibody |
abx146319-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protein Misato Homolog 1 (MSTO1) Antibody |
20-abx301709 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bovine Protein misato homolog 1, MSTO1 ELISA KIT |
ELI-20864b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Protein misato homolog 1, MSTO1 ELISA KIT |
ELI-23224h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein misato homolog 1 (MSTO1) ELISA Kit |
abx385159-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Msto1 ELISA Kit| Mouse Protein misato homolog 1 ELISA Kit |
EF015532 |
Lifescience Market |
96 Tests |
EUR 689 |
Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), APC |
4-PAS031Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with APC. |
Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAS031Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with Biotin. |
Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), Cy3 |
4-PAS031Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with Cy3. |
Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), FITC |
4-PAS031Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with FITC. |
Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), HRP |
4-PAS031Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with HRP. |
Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), PE |
4-PAS031Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with PE. |
Protein Misato Homolog 1 (MSTO1) Antibody (HRP) |
20-abx311515 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Misato Homolog 1 (MSTO1) Antibody (FITC) |
20-abx311516 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Misato Homolog 1 (MSTO1) Antibody (Biotin) |
20-abx311517 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MSTO1 ELISA Kit| Bovine Protein misato homolog 1 ELISA Kit |
EF011608 |
Lifescience Market |
96 Tests |
EUR 689 |
Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAS031Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 628.00
-
EUR 7258.00
-
EUR 1912.00
-
EUR 842.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with APC-Cy7. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
MSTO1 ELISA Kit (Mouse) (OKCD01100) |
OKCD01100 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Involved in the regulation of mitochondrial distribution and morphology.By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.124 ng/mL |
Mouse MSTO1 shRNA Plasmid |
20-abx981703 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MSTO1 Recombinant Protein (Mouse) |
RP151880 |
ABM |
100 ug |
Ask for price |
MSTO1 antibody |
22173-100ul |
SAB |
100ul |
EUR 390 |
MSTO1 antibody |
70R-12878 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal MSTO1 antibody |
MSTO1 Antibody |
1-CSB-PA880106LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MSTO1. Recognizes MSTO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MSTO1 antibody |
70R-8488 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MSTO1 antibody |
MSTO1 siRNA |
20-abx924826 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MSTO1 siRNA |
20-abx924827 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MSTO1 |
YF-PA19583 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to MSTO1 |
Msto1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4214102 |
ABM |
1.0 ug DNA |
EUR 154 |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Msto1 ORF Vector (Mouse) (pORF) |
ORF050628 |
ABM |
1.0 ug DNA |
EUR 506 |
Mouse Notch Homolog 1 ELISA kit |
E03N0594-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Notch Homolog 1 ELISA kit |
E03N0594-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Notch Homolog 1 ELISA kit |
E03N0594-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
MSTO1 Blocking Peptide |
33R-10232 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MSTO1 antibody, catalog no. 70R-8488 |
MSTO1 cloning plasmid |
CSB-CL880106HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1713
- Sequence: atggcgggcggggcccgggaggtgctcacactgcagttgggacattttgccggtttcgtgggcgcgcactggtggaaccagcaggatgctgcgctgggccgagcgaccgattccaaggagcccccgggagagctgtgccccgacgtcctgtatcgtacgggccggacgctgcacg
- Show more
|
Description: A cloning plasmid for the MSTO1 gene. |
MSTO1 Polyclonal Antibody |
A59934 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Anti-CELSR3/Flamingo Homolog 1 Antibody |
A07204-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat. |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Msto1 sgRNA CRISPR Lentivector set (Mouse) |
K4214101 |
ABM |
3 x 1.0 ug |
EUR 339 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
DLR-DAB1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
DLR-DAB1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
DLR-Slit1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
DLR-Slit1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Dab1/ Disabled homolog 1 ELISA Kit |
E0377Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse Achaete scute homolog 1 ELISA kit |
E03A0079-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Achaete scute homolog 1 ELISA kit |
E03A0079-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Achaete scute homolog 1 ELISA kit |
E03A0079-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Crumbs homolog 1(CRB1) ELISA kit |
E03C2038-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Crumbs homolog 1(CRB1) ELISA kit |
E03C2038-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Crumbs homolog 1(CRB1) ELISA kit |
E03C2038-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
E03P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
E03P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
E03P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit |
20-abx153918 |
Abbexa |
-
EUR 5640.00
-
EUR 3009.00
-
EUR 707.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
20-abx154688 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit |
abx254020-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse Disabled homolog 1 |
EK3038 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Robo1/ Roundabout homolog 1 ELISA Kit |
E1276Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse Roundabout homolog 1 (ROBO1) ELISA Kit |
abx555892-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Dachshund Homolog 1 (DACH1) ELISA Kit |
abx556123-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Mouse Frizzled Homolog 1 (FZD1) ELISA Kit |
abx515256-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Nitrilase homolog 1 (NIT1) ELISA Kit |
abx390062-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Dab1(Disabled homolog 1) ELISA Kit |
EM0551 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.78-50 ng/ml
- Uniprot ID: P97318
- Alias: Dab1/DAB1/Disabled homolog 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml |
Mouse Roundabout homolog 1, Robo1 ELISA KIT |
ELI-38645m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RDR-DAB1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RDR-DAB1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
RD-Slit1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
RD-Slit1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
SED354Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
SED354Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
SED354Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
SED354Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
4-SED354Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Slit Homolog 1 elisa. Alternative names of the recognized antigen: MEGF4
- SLIL1
- SLIT3
- Multiple epidermal growth factor-like domains protein 4
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Slit Homolog 1 (Slit1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RD-DAB1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RD-DAB1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
RDR-Slit1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
RDR-Slit1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Dach1 ELISA Kit| Mouse Dachshund homolog 1 ELISA Kit |
EF014622 |
Lifescience Market |
96 Tests |
EUR 689 |
Nit1 ELISA Kit| Mouse Nitrilase homolog 1 ELISA Kit |
EF015701 |
Lifescience Market |
96 Tests |
EUR 689 |
Dab1 ELISA Kit| Mouse Disabled homolog 1 ELISA Kit |
EF013178 |
Lifescience Market |
96 Tests |
EUR 689 |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
MSTO1 Antibody, HRP conjugated |
1-CSB-PA880106LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MSTO1. Recognizes MSTO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MSTO1 Antibody, FITC conjugated |
1-CSB-PA880106LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MSTO1. Recognizes MSTO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MSTO1 Antibody, Biotin conjugated |
1-CSB-PA880106LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MSTO1. Recognizes MSTO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human MSTO1 shRNA Plasmid |
20-abx960510 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MSTO1 Recombinant Protein (Human) |
RP020197 |
ABM |
100 ug |
Ask for price |
MSTO1 Recombinant Protein (Rat) |
RP212594 |
ABM |
100 ug |
Ask for price |
Msto1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6362102 |
ABM |
1.0 ug DNA |
EUR 154 |
MSTO1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1351202 |
ABM |
1.0 ug DNA |
EUR 154 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Mouse Protein sel- 1 homolog 1, Sel1l ELISA KIT |
ELI-42374m |
Lifescience Market |
96 Tests |
EUR 865 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Msto1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4214103 |
ABM |
1.0 ug DNA |
EUR 154 |
Msto1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4214104 |
ABM |
1.0 ug DNA |
EUR 154 |
MSTO1 Protein Vector (Mouse) (pPB-C-His) |
PV202510 |
ABM |
500 ng |
EUR 603 |
MSTO1 Protein Vector (Mouse) (pPB-N-His) |
PV202511 |
ABM |
500 ng |
EUR 603 |
MSTO1 Protein Vector (Mouse) (pPM-C-HA) |
PV202512 |
ABM |
500 ng |
EUR 603 |
MSTO1 Protein Vector (Mouse) (pPM-C-His) |
PV202513 |
ABM |
500 ng |
EUR 603 |
Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit |
EMI2200-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Snail Homolog ELISA kit |
E03S0441-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Snail Homolog ELISA kit |
E03S0441-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Snail Homolog ELISA kit |
E03S0441-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Ascl1 ELISA Kit| Mouse Achaete-scute homolog 1 ELISA Kit |
EF014112 |
Lifescience Market |
96 Tests |
EUR 689 |
Cby1 ELISA Kit| Mouse Protein chibby homolog 1 ELISA Kit |
EF014473 |
Lifescience Market |
96 Tests |
EUR 689 |
Disp1 ELISA Kit| Mouse Protein dispatched homolog 1 ELISA Kit |
EF014711 |
Lifescience Market |
96 Tests |
EUR 689 |
Jagn1 ELISA Kit| Mouse Protein jagunal homolog 1 ELISA Kit |
EF015301 |
Lifescience Market |
96 Tests |
EUR 689 |
Ptch1 ELISA Kit| Mouse Protein patched homolog 1 ELISA Kit |
EF015804 |
Lifescience Market |
96 Tests |
EUR 689 |
Sav1 ELISA Kit| Mouse Protein salvador homolog 1 ELISA Kit |
EF016133 |
Lifescience Market |
96 Tests |
EUR 689 |
Fermt1 ELISA Kit| Mouse Fermitin family homolog 1 ELISA Kit |
EF013237 |
Lifescience Market |
96 Tests |
EUR 689 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Mouse Delta Like 1 Homolog (dLK1) ELISA Kit |
DLR-dLK1-Mu-48T |
DL Develop |
48T |
EUR 566 |
- Should the Mouse Delta Like 1 Homolog (dLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Delta Like 1 Homolog (dLK1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Delta Like 1 Homolog (dLK1) ELISA Kit |
DLR-dLK1-Mu-96T |
DL Develop |
96T |
EUR 741 |
- Should the Mouse Delta Like 1 Homolog (dLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Delta Like 1 Homolog (dLK1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
DLR-EGLN1-Mu-48T |
DL Develop |
48T |
EUR 566 |
- Should the Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
DLR-EGLN1-Mu-96T |
DL Develop |
96T |
EUR 741 |
- Should the Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Fermt1/ Fermitin family homolog 1 ELISA Kit |
E0522Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse Dlk1/ Protein delta homolog 1 ELISA Kit |
E0406Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse seminal plasma protein homolog 1 ELISA kit |
E03B0856-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse seminal plasma protein homolog 1 ELISA kit |
E03B0856-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse seminal plasma protein homolog 1 ELISA kit |
E03B0856-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Chromobox protein homolog 1(CBX1) ELISA kit |
E03C1420-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Chromobox protein homolog 1(CBX1) ELISA kit |
E03C1420-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Chromobox protein homolog 1(CBX1) ELISA kit |
E03C1420-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit |
E03S0269-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit |
E03S0269-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit |
E03S0269-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse delta Like 1 Homolog (dLK1) ELISA Kit |
20-abx153909 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit |
abx254902-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Fermitin Family Homolog 1 (FERMT1) ELISA Kit |
abx254968-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse Fermitin family homolog 1 |
EK3461 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Fermitin family homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Protein Hook homolog 1, Hook1 ELISA KIT |
ELI-13075m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein tweety homolog 1, Ttyh1 ELISA KIT |
ELI-17045m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein canopy homolog 1, Cnpy1 ELISA KIT |
ELI-09145m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Disks large homolog 1, Dlg1 ELISA KIT |
ELI-09200m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Chromobox protein homolog 1, Cbx1 ELISA KIT |
ELI-10762m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Slit homolog 1 protein, Slit1 ELISA KIT |
ELI-18718m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Single- minded homolog 1, Sim1 ELISA KIT |
ELI-19165m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Mitochondrial carrier homolog 1, Mtch1 ELISA KIT |
ELI-19361m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein jagunal homolog 1, Jagn1 ELISA KIT |
ELI-19920m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein NipSnap homolog 1, Nipsnap1 ELISA KIT |
ELI-20721m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Notchless protein homolog 1, Nle1 ELISA KIT |
ELI-23641m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Achaete- scute homolog 1, Ascl1 ELISA KIT |
ELI-23996m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein angel homolog 1, Angel1 ELISA KIT |
ELI-24203m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein chibby homolog 1, Cby1 ELISA KIT |
ELI-24880m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein Smaug homolog 1, Samd4a ELISA KIT |
ELI-29113m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein spinster homolog 1, Spns1 ELISA KIT |
ELI-29123m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein spire homolog 1, Spire1 ELISA KIT |
ELI-30168m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Eyes absent homolog 1, Eya1 ELISA KIT |
ELI-31369m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein delta homolog 1, Dlk1 ELISA KIT |
ELI-03464m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Fermitin family homolog 1, Fermt1 ELISA KIT |
ELI-04835m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein diaphanous homolog 1, Diaph1 ELISA KIT |
ELI-26053m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein flightless- 1 homolog, Flii ELISA KIT |
ELI-26738m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein dispatched homolog 1, Disp1 ELISA KIT |
ELI-26868m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Homer protein homolog 1, Homer1 ELISA KIT |
ELI-07972m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein sprouty homolog 1, Spry1 ELISA KIT |
ELI-53435m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse RNA exonuclease 1 homolog, Rexo1 ELISA KIT |
ELI-42846m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein zer- 1 homolog, Zer1 ELISA KIT |
ELI-44277m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein DDI1 homolog 1, Ddi1 ELISA KIT |
ELI-46738m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein delta homolog 1(DLK1) ELISA kit |
CSB-EL006945MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein delta homolog 1 (DLK1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Protein delta homolog 1(DLK1) ELISA kit |
1-CSB-EL006945MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein delta homolog 1(DLK1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Achaete-Scute Homolog 1 (ASCL1) ELISA Kit |
abx555606-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Protein delta homolog 1 (DLK1) ELISA Kit |
abx574066-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Protein Atonal Homolog 1 (ATOH1) ELISA Kit |
abx512375-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Protein Chibby Homolog 1 (CBY1) ELISA Kit |
abx388848-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Protein dispatched homolog 1 (DISP1) ELISA Kit |
abx389081-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Protein jagunal homolog 1 (JAGN1) ELISA Kit |
abx389667-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Mitochondrial carrier homolog 1 (MTCH1) ELISA Kit |
abx389898-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Protein patched homolog 1 (PTCH1) ELISA Kit |
abx390165-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Protein salvador homolog 1 (SAV1) ELISA Kit |
abx390491-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse Slit1 (Slit Homolog 1) |
ELK6408 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Slit Homolog 1 (Slit1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Slit Homolo
- Show more
|
Description: A sandwich ELISA kit for detection of Slit Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Fermt1(Fermitin family homolog 1) ELISA Kit |
EM0617 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: P59113
- Alias: Fermt1/Fermitin family homolog 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml |
Mouse Protein PAT1 homolog 1, Patl1 ELISA KIT |
ELI-35757m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein salvador homolog 1, Sav1 ELISA KIT |
ELI-35944m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein slowmo homolog 1, Slmo1 ELISA KIT |
ELI-41004m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein asteroid homolog 1, Aste1 ELISA KIT |
ELI-49583m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse TRIB1 (Tribbles homolog 1) ELISA Kit (CUSTOM) |
ELI-36571m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein patched homolog 1, Ptch1 ELISA KIT |
ELI-36765m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Mouse Dapper homolog 1 (DACT1) |
KTE71341-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by DACT1 belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Dapper homolog 1 (DACT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Dapper homolog 1 (DACT1) |
KTE71341-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by DACT1 belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Dapper homolog 1 (DACT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Dapper homolog 1 (DACT1) |
KTE71341-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by DACT1 belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Dapper homolog 1 (DACT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Dachshund homolog 1 (DACH1) |
KTE71343-48T |
Abbkine |
48T |
EUR 332 |
- DACH1 encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Dros
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Dachshund homolog 1 (DACH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Dachshund homolog 1 (DACH1) |
KTE71343-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DACH1 encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Dros
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Dachshund homolog 1 (DACH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Dachshund homolog 1 (DACH1) |
KTE71343-96T |
Abbkine |
96T |
EUR 539 |
- DACH1 encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Dros
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Dachshund homolog 1 (DACH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Pygopus homolog 1 (PYGO1) |
KTE70589-48T |
Abbkine |
48T |
EUR 332 |
- WNT signaling controls many fundamental processes during animal development. WNT transduction is mediated by the association of beta-catenin with nuclear TCF DNA-binding factors.Lgs encodes the homolog of human BCL9, and the authors provided genetic
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Pygopus homolog 1 (PYGO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Pygopus homolog 1 (PYGO1) |
KTE70589-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- WNT signaling controls many fundamental processes during animal development. WNT transduction is mediated by the association of beta-catenin with nuclear TCF DNA-binding factors.Lgs encodes the homolog of human BCL9, and the authors provided genetic
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Pygopus homolog 1 (PYGO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Pygopus homolog 1 (PYGO1) |
KTE70589-96T |
Abbkine |
96T |
EUR 539 |
- WNT signaling controls many fundamental processes during animal development. WNT transduction is mediated by the association of beta-catenin with nuclear TCF DNA-binding factors.Lgs encodes the homolog of human BCL9, and the authors provided genetic
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Pygopus homolog 1 (PYGO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Delta Like 1 Homolog (dLK1) ELISA Kit |
RDR-dLK1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Mouse Delta Like 1 Homolog (dLK1) ELISA Kit |
RDR-dLK1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
RDR-EGLN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
RDR-EGLN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Mouse Delta Like 1 Homolog ELISA Kit (dLK1) |
RK02751 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Delta Like 1 Homolog (dLK1) ELISA Kit |
RD-dLK1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse Delta Like 1 Homolog (dLK1) ELISA Kit |
RD-dLK1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
RD-EGLN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
RD-EGLN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
Mouse MSTO1(Misato Homolog 1) ELISA Kit