Mouse MSTO1(Misato Homolog 1) ELISA Kit
To Order Contact us: [email protected]
 ELISA Kit) Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
|
RDR-MSTO1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
|
RD-MSTO1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
|
RD-MSTO1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
|
20-abx154390 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
|
SES031Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
|
SES031Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
|
SES031Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
|
SES031Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
|
4-SES031Mu |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Misato Homolog 1 elisa. Alternative names of the recognized antigen: MST
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Misato Homolog 1 (MSTO1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
 Antibody) Misato Homolog 1 (MSTO1) Antibody |
|
20-abx177572 |
Abbexa |
|
|
|
|
Misato Homolog 1 (MSTO1) Antibody |
|
20-abx129456 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
) Recombinant Misato Homolog 1 (MSTO1) |
|
4-RPS031Mu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q2YDW2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 42.8kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Mouse Misato Homolog 1 expressed in: E.coli |
 Protein) Mouse Misato Homolog 1 (MSTO1) Protein |
|
20-abx167304 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 CLIA Kit) Mouse Misato Homolog 1 (MSTO1) CLIA Kit |
|
20-abx496242 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 Mouse Protein misato homolog 1, Msto1 ELISA KIT |
|
ELI-12984m |
Lifescience Market |
96 Tests |
EUR 865 |
) ELISA kit for Mouse MSTO1 (Misato Homolog 1) |
|
ELK7988 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Misato Homolog 1 (MSTO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Misato Ho
- Show more
|
|
Description: A sandwich ELISA kit for detection of Misato Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 Polyclonal Antibody (Mouse)) Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse) |
|
4-PAS031Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1) |
 Antibody) Protein Misato Homolog 1 (MSTO1) Antibody |
|
abx146319-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protein Misato Homolog 1 (MSTO1) Antibody |
|
20-abx301709 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Bovine Protein misato homolog 1, MSTO1 ELISA KIT |
|
ELI-20864b |
Lifescience Market |
96 Tests |
EUR 928 |
 Human Protein misato homolog 1, MSTO1 ELISA KIT |
|
ELI-23224h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA Kit) Human Protein misato homolog 1 (MSTO1) ELISA Kit |
|
abx385159-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Msto1 ELISA Kit| Mouse Protein misato homolog 1 ELISA Kit |
|
EF015532 |
Lifescience Market |
96 Tests |
EUR 689 |
 Polyclonal Antibody (Mouse), APC) Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), APC |
|
4-PAS031Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with APC. |
 Polyclonal Antibody (Mouse), Biotinylated) Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), Biotinylated |
|
4-PAS031Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Mouse), Cy3) Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), Cy3 |
|
4-PAS031Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Mouse), FITC) Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), FITC |
|
4-PAS031Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with FITC. |
 Polyclonal Antibody (Mouse), HRP) Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), HRP |
|
4-PAS031Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with HRP. |
 Polyclonal Antibody (Mouse), PE) Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), PE |
|
4-PAS031Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with PE. |
 Antibody (HRP)) Protein Misato Homolog 1 (MSTO1) Antibody (HRP) |
|
20-abx311515 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Protein Misato Homolog 1 (MSTO1) Antibody (FITC) |
|
20-abx311516 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Protein Misato Homolog 1 (MSTO1) Antibody (Biotin) |
|
20-abx311517 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 MSTO1 ELISA Kit| Bovine Protein misato homolog 1 ELISA Kit |
|
EF011608 |
Lifescience Market |
96 Tests |
EUR 689 |
 Polyclonal Antibody (Mouse), APC-Cy7) Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), APC-Cy7 |
|
4-PAS031Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 628.00
-
EUR 7258.00
-
EUR 1912.00
-
EUR 842.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSTO1 (Leu13~Pro363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with APC-Cy7. |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 (OKCD01100)) MSTO1 ELISA Kit (Mouse) (OKCD01100) |
|
OKCD01100 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
|
Description: Description of target: Involved in the regulation of mitochondrial distribution and morphology.By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.124 ng/mL |
 Mouse MSTO1 shRNA Plasmid |
|
20-abx981703 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MSTO1 Recombinant Protein (Mouse) |
|
RP151880 |
ABM |
100 ug |
Ask for price |
 MSTO1 antibody |
|
22173-100ul |
SAB |
100ul |
EUR 390 |
MSTO1 antibody |
|
70R-12878 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal MSTO1 antibody |
 MSTO1 Antibody |
|
1-CSB-PA880106LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against MSTO1. Recognizes MSTO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MSTO1 antibody |
|
70R-8488 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal MSTO1 antibody |
 MSTO1 siRNA |
|
20-abx924826 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MSTO1 siRNA |
|
20-abx924827 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-MSTO1 |
|
YF-PA19583 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to MSTO1 |
 (Target 1)) Msto1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4214102 |
ABM |
1.0 ug DNA |
EUR 154 |
) mRNAExpress mRNA Synthesis kit (5 reactions) |
|
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
) PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
) PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
 (pORF)) Msto1 ORF Vector (Mouse) (pORF) |
|
ORF050628 |
ABM |
1.0 ug DNA |
EUR 506 |
 Mouse Notch Homolog 1 ELISA kit |
|
E03N0594-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Notch Homolog 1 ELISA kit |
|
E03N0594-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Notch Homolog 1 ELISA kit |
|
E03N0594-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 MSTO1 Blocking Peptide |
|
33R-10232 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MSTO1 antibody, catalog no. 70R-8488 |
 MSTO1 cloning plasmid |
|
CSB-CL880106HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1713
- Sequence: atggcgggcggggcccgggaggtgctcacactgcagttgggacattttgccggtttcgtgggcgcgcactggtggaaccagcaggatgctgcgctgggccgagcgaccgattccaaggagcccccgggagagctgtgccccgacgtcctgtatcgtacgggccggacgctgcacg
- Show more
|
|
Description: A cloning plasmid for the MSTO1 gene. |
 MSTO1 Polyclonal Antibody |
|
A59934 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 with goat anti-rabbit HRP secondary antibody) ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
|
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
|
) PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
 Anti-CELSR3/Flamingo Homolog 1 Antibody |
|
A07204-1 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat. |
) PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) Msto1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4214101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
 ELISA Kit) Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
|
DLR-DAB1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
|
DLR-DAB1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
 ELISA Kit) Mouse Slit Homolog 1 (Slit1) ELISA Kit |
|
DLR-Slit1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
|
DLR-Slit1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
 Mouse Dab1/ Disabled homolog 1 ELISA Kit |
|
E0377Mo |
Sunlong |
1 Kit |
EUR 632 |
 Mouse Achaete scute homolog 1 ELISA kit |
|
E03A0079-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Achaete scute homolog 1 ELISA kit |
|
E03A0079-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Achaete scute homolog 1 ELISA kit |
|
E03A0079-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Mouse Crumbs homolog 1(CRB1) ELISA kit |
|
E03C2038-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Crumbs homolog 1(CRB1) ELISA kit |
|
E03C2038-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Crumbs homolog 1(CRB1) ELISA kit |
|
E03C2038-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Mouse Protein pellino homolog 1 ELISA kit |
|
E03P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
|
E03P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
|
E03P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA Kit) Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit |
|
20-abx153918 |
Abbexa |
-
EUR 5640.00
-
EUR 3009.00
-
EUR 707.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
|
20-abx154688 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit |
|
abx254020-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
 ELISA kit for Mouse Disabled homolog 1 |
|
EK3038 |
SAB |
96 tests |
EUR 670 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
 Mouse Robo1/ Roundabout homolog 1 ELISA Kit |
|
E1276Mo |
Sunlong |
1 Kit |
EUR 632 |
 ELISA Kit) Mouse Roundabout homolog 1 (ROBO1) ELISA Kit |
|
abx555892-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Dachshund Homolog 1 (DACH1) ELISA Kit |
|
abx556123-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
 ELISA Kit) Mouse Frizzled Homolog 1 (FZD1) ELISA Kit |
|
abx515256-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Nitrilase homolog 1 (NIT1) ELISA Kit |
|
abx390062-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Dab1(Disabled homolog 1) ELISA Kit |
|
EM0551 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.78-50 ng/ml
- Uniprot ID: P97318
- Alias: Dab1/DAB1/Disabled homolog 1
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml |
Mouse MSTO1(Misato Homolog 1) ELISA Kit
ELISA Kit)
