Mouse MSTO1(Misato Homolog 1) ELISA Kit

Mouse MSTO1(Misato Homolog 1) ELISA Kit

To Order Contact us: [email protected]

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

RDR-MSTO1-Mu-96Tests 96 Tests
EUR 840

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

RD-MSTO1-Mu-48Tests 48 Tests
EUR 577

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

RD-MSTO1-Mu-96Tests 96 Tests
EUR 802

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

20-abx154390
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

SES031Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

SES031Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

SES031Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

SES031Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit

4-SES031Mu
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Misato Homolog 1 elisa. Alternative names of the recognized antigen: MST
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Misato Homolog 1 (MSTO1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Misato Homolog 1 (MSTO1) Antibody

20-abx177572
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Misato Homolog 1 (MSTO1) Antibody

20-abx129456
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Recombinant Misato Homolog 1 (MSTO1)

4-RPS031Mu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q2YDW2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Misato Homolog 1 expressed in: E.coli

Mouse Misato Homolog 1 (MSTO1) Protein

20-abx167304
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Misato Homolog 1 (MSTO1) CLIA Kit

20-abx496242
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Misato Homolog 1(MSTO1)ELISA Kit

QY-E04795 96T
EUR 361

Mouse Protein misato homolog 1, Msto1 ELISA KIT

ELI-12984m 96 Tests
EUR 865

ELISA kit for Mouse MSTO1 (Misato Homolog 1)

ELK7988 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Misato Homolog 1 (MSTO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Misato Ho
  • Show more
Description: A sandwich ELISA kit for detection of Misato Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse)

4-PAS031Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1)

Protein Misato Homolog 1 (MSTO1) Antibody

abx146319-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Misato Homolog 1 (MSTO1) Antibody

20-abx301709
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bovine Protein misato homolog 1, MSTO1 ELISA KIT

ELI-20864b 96 Tests
EUR 928

Human Protein misato homolog 1, MSTO1 ELISA KIT

ELI-23224h 96 Tests
EUR 824

Human Protein misato homolog 1 (MSTO1) ELISA Kit

abx385159-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Msto1 ELISA Kit| Mouse Protein misato homolog 1 ELISA Kit

EF015532 96 Tests
EUR 689

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), APC

4-PAS031Mu01-APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with APC.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), Biotinylated

4-PAS031Mu01-Biotin
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with Biotin.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), Cy3

4-PAS031Mu01-Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with Cy3.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), FITC

4-PAS031Mu01-FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with FITC.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), HRP

4-PAS031Mu01-HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with HRP.

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), PE

4-PAS031Mu01-PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with PE.

Protein Misato Homolog 1 (MSTO1) Antibody (HRP)

20-abx311515
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Misato Homolog 1 (MSTO1) Antibody (FITC)

20-abx311516
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Misato Homolog 1 (MSTO1) Antibody (Biotin)

20-abx311517
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MSTO1 ELISA Kit| Bovine Protein misato homolog 1 ELISA Kit

EF011608 96 Tests
EUR 689

Misato Homolog 1 (MSTO1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAS031Mu01-APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSTO1 (Leu13~Pro363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Misato Homolog 1 (MSTO1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

MSTO1 ELISA Kit (Mouse) (OKCD01100)

OKCD01100 96 Wells
EUR 936
Description: Description of target: Involved in the regulation of mitochondrial distribution and morphology.By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.124 ng/mL

MSTO1 ELISA KIT|Human

EF005279 96 Tests
EUR 689

Mouse MSTO1 shRNA Plasmid

20-abx981703
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MSTO1 Recombinant Protein (Mouse)

RP151880 100 ug Ask for price

MSTO1 antibody

22173-100ul 100ul
EUR 390

MSTO1 antibody

70R-12878 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal MSTO1 antibody

MSTO1 Antibody

1-CSB-PA880106LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSTO1. Recognizes MSTO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MSTO1 antibody

70R-8488 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MSTO1 antibody

MSTO1 siRNA

20-abx924826
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSTO1 siRNA

20-abx924827
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-MSTO1

YF-PA19583 50 ug
EUR 363
Description: Mouse polyclonal to MSTO1

Msto1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4214102 1.0 ug DNA
EUR 154

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Msto1 ORF Vector (Mouse) (pORF)

ORF050628 1.0 ug DNA
EUR 506

Mouse Notch Homolog 1 ELISA kit

E03N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Notch Homolog 1 ELISA kit

E03N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Notch Homolog 1 ELISA kit

E03N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MSTO1 Blocking Peptide

33R-10232 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MSTO1 antibody, catalog no. 70R-8488

MSTO1 cloning plasmid

CSB-CL880106HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1713
  • Sequence: atggcgggcggggcccgggaggtgctcacactgcagttgggacattttgccggtttcgtgggcgcgcactggtggaaccagcaggatgctgcgctgggccgagcgaccgattccaaggagcccccgggagagctgtgccccgacgtcctgtatcgtacgggccggacgctgcacg
  • Show more
Description: A cloning plasmid for the MSTO1 gene.

MSTO1 Polyclonal Antibody

A59934 100 µg
EUR 570.55
Description: The best epigenetics products

pENTR223-MSTO1 vector

PVT11773 2 ug
EUR 304

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Msto1 sgRNA CRISPR Lentivector set (Mouse)

K4214101 3 x 1.0 ug
EUR 339

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Mu-48T 48T
EUR 527
  • Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Mu-96T 96T
EUR 688
  • Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

DLR-Slit1-Mu-48T 48T
EUR 527
  • Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

DLR-Slit1-Mu-96T 96T
EUR 688
  • Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Dab1/ Disabled homolog 1 ELISA Kit

E0377Mo 1 Kit
EUR 632

Mouse Achaete scute homolog 1 ELISA kit

E03A0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Achaete scute homolog 1 ELISA kit

E03A0079-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Achaete scute homolog 1 ELISA kit

E03A0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crumbs homolog 1(CRB1) ELISA kit

E03C2038-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crumbs homolog 1(CRB1) ELISA kit

E03C2038-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crumbs homolog 1(CRB1) ELISA kit

E03C2038-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit

E03P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit

E03P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit

E03P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit

20-abx153918
  • EUR 5640.00
  • EUR 3009.00
  • EUR 707.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Slit Homolog 1 (Slit1) ELISA Kit

20-abx154688
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit

abx254020-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

ELISA kit for Mouse Disabled homolog 1

EK3038 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Robo1/ Roundabout homolog 1 ELISA Kit

E1276Mo 1 Kit
EUR 632

Mouse Nanos homolog 1, Nanos1 ELISA KIT

ELI-22326m 96 Tests
EUR 865

Mouse Pygopus homolog 1, Pygo1 ELISA KIT

ELI-30536m 96 Tests
EUR 865

Mouse Disabled homolog 1, Dab1 ELISA KIT

ELI-04119m 96 Tests
EUR 865

Mouse Dachshund homolog 1, Dach1 ELISA KIT

ELI-07865m 96 Tests
EUR 865

Mouse Teashirt homolog 1, Tshz1 ELISA KIT

ELI-51860m 96 Tests
EUR 865

Mouse Roundabout homolog 1 (ROBO1) ELISA Kit

abx555892-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Dachshund Homolog 1 (DACH1) ELISA Kit

abx556123-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Frizzled Homolog 1 (FZD1) ELISA Kit

abx515256-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Nitrilase homolog 1 (NIT1) ELISA Kit

abx390062-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dab1(Disabled homolog 1) ELISA Kit

EM0551 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: P97318
  • Alias: Dab1/DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Mouse Dapper homolog 1, Dact1 ELISA KIT

ELI-31901m 96 Tests
EUR 865

Mouse MSTO1(Misato Homolog 1) ELISA Kit