Rat AXL(AXL Receptor Tyrosine Kinase) ELISA Kit

Rat AXL(AXL Receptor Tyrosine Kinase) ELISA Kit

To Order Contact us: [email protected]

Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3046.74
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in serum, plasma and other biological fluids.

Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
4-SEL230Ra	Cloud-Clone	EUR 5672.00 EUR 2997.00 EUR 744.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as AXL Receptor Tyrosine Kinase elisa. Alternative names of the recognized antigen: UFO JTK11 Tyrosine-protein kinase receptor UFO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Recombinant AXL Receptor Tyrosine Kinase (AXL)
4-RPL230Hu01	Cloud-Clone	EUR 474.53 EUR 230.00 EUR 1504.48 EUR 568.16 EUR 1036.32 EUR 380.00 EUR 3611.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.8kDa Isoelectric Point: 4.6
Description: Recombinant Human AXL Receptor Tyrosine Kinase expressed in: E.coli

Recombinant AXL Receptor Tyrosine Kinase (AXL)
4-RPL230Ra01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8VIA0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 23.5kDa Isoelectric Point: Inquire
Description: Recombinant Rat AXL Receptor Tyrosine Kinase expressed in: E.coli

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
4-SEL230Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as AXL Receptor Tyrosine Kinase elisa. Alternative names of the recognized antigen: UFO JTK11 Tyrosine-protein kinase receptor UFO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human AXL Receptor Tyrosine Kinase (AXL) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat AXL (AXL Receptor Tyrosine Kinase)
ELK8078	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to AXL Receptor Tyrosine Kinase (AXL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of AXL Receptor Tyrosine Kinase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat)
4-PAL230Ra01	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXL (Lys21~His202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL)

ELISA kit for Human AXL (AXL Receptor Tyrosine Kinase)
ELK7559	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to AXL Receptor Tyrosine Kinase (AXL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of AXL Receptor Tyrosine Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), APC
4-PAL230Ra01-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXL (Lys21~His202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with APC.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), Biotinylated
4-PAL230Ra01-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXL (Lys21~His202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with Biotin.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), Cy3
4-PAL230Ra01-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXL (Lys21~His202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with Cy3.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), FITC
4-PAL230Ra01-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXL (Lys21~His202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with FITC.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), HRP
4-PAL230Ra01-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXL (Lys21~His202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with HRP.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), PE
4-PAL230Ra01-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXL (Lys21~His202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with PE.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), APC-Cy7
4-PAL230Ra01-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXL (Lys21~His202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with APC-Cy7.

Rat Tyrosine-Protein Kinase Receptor UFO (AXL) ELISA Kit
20-abx155242	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Tyrosine-Protein Kinase Receptor UFO (AXL) Protein
20-abx168518	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx130417	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx000747	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx141090	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx036741-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033505-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033505-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033506-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033506-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033507-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033507-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx011796-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx015709-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx028539-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx028539-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx326400	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx327038	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx334374	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx230754-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx171380	Abbexa	EUR 982.00 EUR 495.00	1 mg 200 ug
Please enquire.

Rat Tyrosine-Protein Kinase Receptor UFO (AXL) CLIA Kit
20-abx495900	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Tyrosine-Protein Kinase Receptor UFO (AXL) ELISA Kit
abx520097-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Tyrosine-Protein Kinase Receptor UFO (AXL) ELISA Kit
abx520098-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human AXL/ Tyrosine-protein kinase receptor UFO ELISA Kit
E0242Hu	Sunlong	1 Kit	EUR 537

Human AXL(Tyrosine-protein kinase receptor UFO) ELISA Kit
EH6594	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Tyrosine- protein kinase receptor UFO, AXL ELISA KIT
ELI-07417h	Lifescience Market	96 Tests	EUR 824

Mouse Tyrosine- protein kinase receptor UFO, Axl ELISA KIT
ELI-07418m	Lifescience Market	96 Tests	EUR 865

Human Tyrosine-Protein Kinase Receptor UFO (AXL) ELISA Kit
20-abx258647	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tyrosine-protein kinase receptor UFO (AXL) ELISA Kit
CSB-EL002476HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Tyrosine-protein kinase receptor UFO (AXL) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tyrosine-protein kinase receptor UFO (AXL) ELISA Kit
1-CSB-EL002476HU	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Tyrosine-protein kinase receptor UFO (AXL) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Tyrosine-protein kinase receptor UFO(AXL) ELISA Kit
CSB-EL002476MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Mouse Tyrosine-protein kinase receptor UFO (AXL) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Tyrosine-protein kinase receptor UFO(AXL) ELISA Kit
1-CSB-EL002476MO	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Mouse Tyrosine-protein kinase receptor UFO(AXL) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Axl/ Tyrosine-protein kinase receptor UFO ELISA Kit
E0154Mo	Sunlong	1 Kit	EUR 546

Axl ELISA Kit| Mouse Tyrosine-protein kinase receptor UFO ELISA
EF014271	Lifescience Market	96 Tests	EUR 689

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody (HRP)
20-abx338143	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody (FITC)
20-abx338144	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody (Biotin)
20-abx338145	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Tyrosine-Protein Kinase Receptor UFO (AXL) CLIA Kit
20-abx495899	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Tyrosine-Protein Kinase Receptor UFO Phospho-Tyr691 (AXL pY691) Antibody
20-abx328449	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

AXL ELISA Kit (Rat) (OKCD04379)
OKCD04379	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.9 ng/mL

AXL ELISA KIT|Human
EF008027	Lifescience Market	96 Tests	EUR 689

Human AXL ELISA Kit
LF-EK50867	Abfrontier	1×96T	EUR 648

Mouse AXL ELISA Kit
LF-EK50868	Abfrontier	1×96T	EUR 648

AXL Antibody
AF8412	Affbiotech	200ul	EUR 376
Description: AXL Antibody detects endogenous levels of total AXL.

AXL siRNA
20-abx908739	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AXL siRNA
20-abx908740	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AXL Antibody
BF0290	Affbiotech	200ul	EUR 376
Description: AXL antibody detects endogenous levels of total AXL.

AXL Antibody
AF7793	Affbiotech	200ul	EUR 376
Description: AXL Antibody detects endogenous levels of AXL.

AXL Antibody
ABF8412	Lifescience Market	100 ug	EUR 438

AXL antibody
70R-51253	Fitzgerald	100 ul	EUR 287
Description: Purified Polyclonal AXL antibody

AXL antibody
70R-9655	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal AXL antibody

Axl Antibody
39365-100ul	SAB	100ul	EUR 390

AXL Antibody
48205-100ul	SAB	100ul	EUR 333

AXL Antibody
48205-50ul	SAB	50ul	EUR 239

AXL antibody
10R-1995	Fitzgerald	100 ul	EUR 327
Description: Mouse monoclonal AXL antibody

AXL antibody
10R-2051	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal AXL antibody

AXL Antibody
1-CSB-PA297707	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AXL. Recognizes AXL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

AXL Antibody
1-CSB-PA326981LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXL. Recognizes AXL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

AXL Antibody
1-CSB-PA030245	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AXL. Recognizes AXL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

anti-AXL
YF-PA10419	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to AXL

anti-AXL
YF-PA10420	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to AXL

anti-AXL
YF-PA10421	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to AXL

anti-AXL
YF-PA23279	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to AXL

anti-AXL
YF-PA27171	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to AXL

ELISA kit for Human AXL
EK5263	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human AXL in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse AXL
EK5264	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse AXL in samples from serum, plasma, tissue homogenates and other biological fluids.

Human AXL PicoKine ELISA Kit
EK0659	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human AXL in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse AXL PicoKine ELISA Kit
EK0660	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse AXL in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

AXL ELISA Kit (Human) (OKBB00411)
OKBB00411	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Tyrosine-protein kinase receptor UFO is an enzyme that in humans is encoded by the AXL gene. The protein encoded by this gene is a member of the receptor tyrosine kinase subfamily. Although it is similar to other receptor tyrosine kinases, the Axl protein represents a unique structure of the extracellular region that juxtaposes IgL and FNIII repeats. It transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K-dependent protein growth-arrest-specific gene 6. It is involved in the stimulation of cell proliferation. This receptor can also mediate cell aggregation by homophilic binding. Axl is a chronic myelogenous leukemia-associated oncogene and also associated with colon cancer and melanoma. It is in close vicinity to the bcl3 oncogene, which is at 19q13.1-q13.2. The Axl gene is evolutionarily conserved between vertebrate species. This gene has two different alternatively spliced transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

AXL ELISA Kit (Mouse) (OKBB00412)
OKBB00412	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Tyrosine-protein kinase receptor UFO is an enzyme that in humans is encoded by the AXL gene. The protein encoded by this gene is a member of the receptor tyrosine kinase subfamily. Although it is similar to other receptor tyrosine kinases, the Axl protein represents a unique structure of the extracellular region that juxtaposes IgL and FNIII repeats. It transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K-dependent protein growth-arrest-specific gene 6. It is involved in the stimulation of cell proliferation. This receptor can also mediate cell aggregation by homophilic binding. Axl is a chronic myelogenous leukemia-associated oncogene and also associated with colon cancer and melanoma. It is in close vicinity to the bcl3 oncogene, which is at 19q13.1-q13.2. The Axl gene is evolutionarily conserved between vertebrate species. This gene has two different alternatively spliced transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

AXL ELISA Kit (Human) (OKCD09290)
OKCD09290	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: The protein encoded by this gene is a member of the receptor tyrosine kinase subfamily. Although it is similar to other receptor tyrosine kinases, this protein represents a unique structure of the extracellular region that juxtaposes IgL and FNIII repeats. It transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K-dependent protein growth-arrest-specific gene 6. It is involved in the stimulation of cell proliferation and can also mediate cell aggregation by homophilic binding. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.112ng/mL

AXL ELISA Kit (Human) (OKEH06861)
OKEH06861	Aviva Systems Biology	96 Wells	EUR 544
Description: Description of target: Receptor tyrosine kinase that transduces signals from the extracellular matrix into the cytoplasm by binding growth factor GAS6 and which is thus regulating many physiological processes including cell survival, cell proliferation, migration and differentiation. Ligand binding at the cell surface induces dimerization and autophosphorylation of AXL. Following activation by ligand, ALX binds and induces tyrosine phosphorylation of PI3-kinase subunits PIK3R1, PIK3R2 and PIK3R3; but also GRB2, PLCG1, LCK and PTPN11. Other downstream substrate candidates for AXL are CBL, NCK2, SOCS1 and TNS2. Recruitment of GRB2 and phosphatidylinositol 3 kinase regulatory subunits by AXL leads to the downstream activation of the AKT kinase. GAS6/AXL signaling plays a role in various processes such as endothelial cell survival during acidification by preventing apoptosis, optimal cytokine signaling during human natural killer cell development, hepatic regeneration, gonadotropin-releasing hormone neuron survival and migration, platelet activation, or regulation of thrombotic responses. Plays also an important role in inhibition of Toll-like receptors (TLRs)-mediated innate immune response.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.31 pg/mL

AXL Blocking Peptide
AF8412-BP	Affbiotech	1mg	EUR 195

AXL Conjugated Antibody
C48205	SAB	100ul	EUR 397

Polyclonal AXL Antibody
APR05948G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AXL . This antibody is tested and proven to work in the following applications:

AXL Blocking Peptide
BF0290-BP	Affbiotech	1mg	EUR 195

AXL Blocking Peptide
AF7793-BP	Affbiotech	1mg	EUR 195

AXL cloning plasmid
CSB-CL326981HU-10ug	Cusabio	10ug	EUR 861
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2685 Sequence: atggcgtggcggtgccccaggatgggcagggtcccgctggcctggtgcttggcgctgtgcggctgggcgtgcatggcccccaggggcacgcaggctgaagaaagtcccttcgtgggcaacccagggaatatcacaggtgcccggggactcacgggcacccttcggtgtcagctcc Show more
Description: A cloning plasmid for the AXL gene.

anti- AXL antibody
FNab00754	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:3000 IP: 1:500-1:2000 Immunogen: AXL receptor tyrosine kinase Uniprot ID: P30530 Gene ID: 558 Research Area: Cancer, Immunology, Signal Transduction, Metabolism
Description: Antibody raised against AXL

Axl Polyclonal Antibody
ES6771-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Axl Polyclonal Antibody
ES6771-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Axl Polyclonal Antibody
ES8372-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Axl Polyclonal Antibody
ES8372-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Axl Polyclonal Antibody
ABP57379-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691 Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691

Axl Polyclonal Antibody
ABP57379-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691 Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691

Axl Polyclonal Antibody
ABP57379-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691 Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691

Axl Polyclonal Antibody
ABP55772-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697 Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697

Axl Polyclonal Antibody
ABP55772-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697 Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697

Axl Polyclonal Antibody
ABP55772-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697 Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697

AXL (pY691) Antibody
abx148474-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

AXL (pY702) Antibody
abx148475-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

AXL Blocking Peptide
20-abx061788	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

AXL (pT697) Antibody
20-abx009871	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

AXL (pY691) Antibody
20-abx249424	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Anti-AXL Antibody
A00226-2	BosterBio	100ug/vial	EUR 294

AXL Rabbit pAb
A0532-100ul	Abclonal	100 ul	EUR 308

AXL Rabbit pAb
A0532-200ul	Abclonal	200 ul	EUR 459

AXL Rabbit pAb
A0532-20ul	Abclonal	20 ul	Ask for price

AXL Rabbit pAb
A0532-50ul	Abclonal	50 ul	Ask for price

AXL antibody (Tyr691)
70R-32634	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal AXL antibody (Tyr691)

AXL Rabbit pAb
A17874-100ul	Abclonal	100 ul	EUR 308

AXL Rabbit pAb
A17874-200ul	Abclonal	200 ul	EUR 459

AXL Rabbit pAb
A17874-20ul	Abclonal	20 ul	EUR 183

AXL Rabbit pAb
A17874-50ul	Abclonal	50 ul	EUR 223

AXL Blocking Peptide
33R-7673	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AXL antibody, catalog no. 70R-9655

Anti-AXL antibody
PAab00754	Lifescience Market	100 ug	EUR 355

anti-AXL (1B3A2)
LF-MA30204	Abfrontier	100 ul	EUR 425
Description: Mouse Monoclonal to AXL

anti-AXL (7E10)
LF-MA30273	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to AXL

pDONR223-AXL Plasmid
PVTB00185S	Lifescience Market	2 ug	EUR 356

Anti-Axl antibody
STJ91791	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Axl.

Anti-Axl antibody
STJ97643	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Axl.

Anti-Axl antibody
STJ97856	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Axl.

Anti-Axl antibody
STJ97857	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Axl.

Anti-Axl Antibody
STJ500198	St John's Laboratory	100 µg	EUR 476

Anti-AXL antibody
STJ22748	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene.

Anti-AXL antibody
STJ119885	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene.

Anti-Axl (2C10)
YF-MA12092	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Axl

Anti-AXL (6C8)
YF-MA10084	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to AXL

Anti-AXL (6G1)
YF-MA10085	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to AXL

Axl ORF Vector (Rat) (pORF)
ORF063895	ABM	1.0 ug DNA	EUR 506

Axl ORF Vector (Rat) (pORF)
ORF063896	ABM	1.0 ug DNA	EUR 506

Phospho-AXL (Tyr691) Antibody
AF8522	Affbiotech	200ul	EUR 376
Description: AXL (Phospho-Tyr691) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr691.

Phospho-AXL (Tyr702) Antibody
AF8523	Affbiotech	200ul	EUR 376
Description: AXL (Phospho-Tyr702) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr702.

Mouse AXL shRNA Plasmid
20-abx973661	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho-AXL (Tyr703) Antibody
AF7293	Affbiotech	200ul	EUR 376
Description: Phospho-AXL (Tyr703) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr703.

AXL (pY697) Blocking Peptide
20-abx064128	Abbexa	EUR 314.00 EUR 509.00	1 mg 5 mg
Shipped within 5-10 working days.

AXL (Phospho- Tyr691) Antibody
ABF8522	Lifescience Market	100 ug	EUR 438

AXL (Phospho- Tyr702) Antibody
ABF8523	Lifescience Market	100 ug	EUR 438

Human AXL shRNA Plasmid
20-abx950384	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human AXL (phosphoY821) peptide
AB-23085-P	Alpha Diagnostics	100ug	EUR 164

Rat AXL(AXL Receptor Tyrosine Kinase) ELISA Kit