Rat AXL(AXL Receptor Tyrosine Kinase) ELISA Kit

Rat AXL(AXL Receptor Tyrosine Kinase) ELISA Kit

To Order Contact us: [email protected]

Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Ra-5x96wellstestplate 5x96-wells test plate
EUR 3046.74
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in serum, plasma and other biological fluids.

Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

  • EUR 5672.00
  • EUR 2997.00
  • EUR 744.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as AXL Receptor Tyrosine Kinase elisa. Alternative names of the recognized antigen: UFO
  • JTK11
  • Tyrosine-protein kinase receptor UFO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Recombinant AXL Receptor Tyrosine Kinase (AXL)

  • EUR 474.53
  • EUR 230.00
  • EUR 1504.48
  • EUR 568.16
  • EUR 1036.32
  • EUR 380.00
  • EUR 3611.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 4.6
Description: Recombinant Human AXL Receptor Tyrosine Kinase expressed in: E.coli

Recombinant AXL Receptor Tyrosine Kinase (AXL)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8VIA0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat AXL Receptor Tyrosine Kinase expressed in: E.coli

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as AXL Receptor Tyrosine Kinase elisa. Alternative names of the recognized antigen: UFO
  • JTK11
  • Tyrosine-protein kinase receptor UFO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human AXL Receptor Tyrosine Kinase (AXL) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat AXL (AXL Receptor Tyrosine Kinase)

ELK8078 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to AXL Receptor Tyrosine Kinase (AXL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of AXL Receptor Tyrosine Kinase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat)

  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL)

ELISA kit for Human AXL (AXL Receptor Tyrosine Kinase)

ELK7559 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to AXL Receptor Tyrosine Kinase (AXL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of AXL Receptor Tyrosine Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), APC

  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with APC.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), Biotinylated

  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with Biotin.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), Cy3

  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with Cy3.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), FITC

  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with FITC.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), HRP

  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with HRP.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), PE

  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with PE.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with APC-Cy7.

Rat Tyrosine-Protein Kinase Receptor UFO (AXL) ELISA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Tyrosine-Protein Kinase Receptor UFO (AXL) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx036741-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx033505-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx033505-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx033506-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx033506-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx033507-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx033507-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx011796-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx015709-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx028539-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx028539-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

abx230754-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody

  • EUR 982.00
  • EUR 495.00
  • 1 mg
  • 200 ug
  • Please enquire.

Rat Tyrosine-Protein Kinase Receptor UFO (AXL) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Tyrosine-Protein Kinase Receptor UFO (AXL) ELISA Kit

abx520097-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Tyrosine-Protein Kinase Receptor UFO (AXL) ELISA Kit

abx520098-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human AXL/ Tyrosine-protein kinase receptor UFO ELISA Kit

E0242Hu 1 Kit
EUR 537

Human AXL(Tyrosine-protein kinase receptor UFO) ELISA Kit

EH6594 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Tyrosine- protein kinase receptor UFO, AXL ELISA KIT

ELI-07417h 96 Tests
EUR 824

Mouse Tyrosine- protein kinase receptor UFO, Axl ELISA KIT

ELI-07418m 96 Tests
EUR 865

Human Tyrosine-Protein Kinase Receptor UFO (AXL) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tyrosine-protein kinase receptor UFO (AXL) ELISA Kit

CSB-EL002476HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Tyrosine-protein kinase receptor UFO (AXL) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tyrosine-protein kinase receptor UFO (AXL) ELISA Kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Tyrosine-protein kinase receptor UFO (AXL) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Tyrosine-protein kinase receptor UFO(AXL) ELISA Kit

CSB-EL002476MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Mouse Tyrosine-protein kinase receptor UFO (AXL) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Tyrosine-protein kinase receptor UFO(AXL) ELISA Kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Mouse Tyrosine-protein kinase receptor UFO(AXL) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Axl/ Tyrosine-protein kinase receptor UFO ELISA Kit

E0154Mo 1 Kit
EUR 546

Axl ELISA Kit| Mouse Tyrosine-protein kinase receptor UFO ELISA

EF014271 96 Tests
EUR 689

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Tyrosine-Protein Kinase Receptor UFO (AXL) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Tyrosine-Protein Kinase Receptor UFO Phospho-Tyr691 (AXL pY691) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

AXL ELISA Kit (Rat) (OKCD04379)

OKCD04379 96 Wells
EUR 1001
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.9 ng/mL


EF008027 96 Tests
EUR 689


LF-EK50867 1×96T
EUR 648


LF-EK50868 1×96T
EUR 648

AXL Antibody

AF8412 200ul
EUR 376
Description: AXL Antibody detects endogenous levels of total AXL.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AXL Antibody

BF0290 200ul
EUR 376
Description: AXL antibody detects endogenous levels of total AXL.

AXL Antibody

AF7793 200ul
EUR 376
Description: AXL Antibody detects endogenous levels of AXL.

AXL Antibody

ABF8412 100 ug
EUR 438

AXL antibody

70R-51253 100 ul
EUR 287
Description: Purified Polyclonal AXL antibody

AXL antibody

70R-9655 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal AXL antibody

Axl Antibody

39365-100ul 100ul
EUR 390

AXL Antibody

48205-100ul 100ul
EUR 333

AXL Antibody

48205-50ul 50ul
EUR 239

AXL antibody

10R-1995 100 ul
EUR 327
Description: Mouse monoclonal AXL antibody

AXL antibody

10R-2051 100 ul
EUR 403
Description: Mouse monoclonal AXL antibody

AXL Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AXL. Recognizes AXL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

AXL Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXL. Recognizes AXL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

AXL Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AXL. Recognizes AXL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000


YF-PA10419 50 ul
EUR 363
Description: Mouse polyclonal to AXL


YF-PA10420 50 ug
EUR 363
Description: Mouse polyclonal to AXL


YF-PA10421 100 ug
EUR 403
Description: Rabbit polyclonal to AXL


YF-PA23279 50 ul
EUR 334
Description: Mouse polyclonal to AXL


YF-PA27171 100 ul
EUR 403
Description: Rabbit polyclonal to AXL

ELISA kit for Human AXL

EK5263 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human AXL in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse AXL

EK5264 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse AXL in samples from serum, plasma, tissue homogenates and other biological fluids.

Human AXL PicoKine ELISA Kit

EK0659 96 wells
EUR 425
Description: For quantitative detection of human AXL in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse AXL PicoKine ELISA Kit

EK0660 96 wells
EUR 425
Description: For quantitative detection of mouse AXL in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

AXL ELISA Kit (Human) (OKBB00411)

OKBB00411 96 Wells
EUR 505
Description: Description of target: Tyrosine-protein kinase receptor UFO is an enzyme that in humans is encoded by the AXL gene. The protein encoded by this gene is a member of the receptor tyrosine kinase subfamily. Although it is similar to other receptor tyrosine kinases, the Axl protein represents a unique structure of the extracellular region that juxtaposes IgL and FNIII repeats. It transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K-dependent protein growth-arrest-specific gene 6. It is involved in the stimulation of cell proliferation. This receptor can also mediate cell aggregation by homophilic binding. Axl is a chronic myelogenous leukemia-associated oncogene and also associated with colon cancer and melanoma. It is in close vicinity to the bcl3 oncogene, which is at 19q13.1-q13.2. The Axl gene is evolutionarily conserved between vertebrate species. This gene has two different alternatively spliced transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

AXL ELISA Kit (Mouse) (OKBB00412)

OKBB00412 96 Wells
EUR 505
Description: Description of target: Tyrosine-protein kinase receptor UFO is an enzyme that in humans is encoded by the AXL gene. The protein encoded by this gene is a member of the receptor tyrosine kinase subfamily. Although it is similar to other receptor tyrosine kinases, the Axl protein represents a unique structure of the extracellular region that juxtaposes IgL and FNIII repeats. It transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K-dependent protein growth-arrest-specific gene 6. It is involved in the stimulation of cell proliferation. This receptor can also mediate cell aggregation by homophilic binding. Axl is a chronic myelogenous leukemia-associated oncogene and also associated with colon cancer and melanoma. It is in close vicinity to the bcl3 oncogene, which is at 19q13.1-q13.2. The Axl gene is evolutionarily conserved between vertebrate species. This gene has two different alternatively spliced transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

AXL ELISA Kit (Human) (OKCD09290)

OKCD09290 96 Wells
EUR 909
Description: Description of target: The protein encoded by this gene is a member of the receptor tyrosine kinase subfamily. Although it is similar to other receptor tyrosine kinases, this protein represents a unique structure of the extracellular region that juxtaposes IgL and FNIII repeats. It transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K-dependent protein growth-arrest-specific gene 6. It is involved in the stimulation of cell proliferation and can also mediate cell aggregation by homophilic binding. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.112ng/mL

AXL ELISA Kit (Human) (OKEH06861)

OKEH06861 96 Wells
EUR 544
Description: Description of target: Receptor tyrosine kinase that transduces signals from the extracellular matrix into the cytoplasm by binding growth factor GAS6 and which is thus regulating many physiological processes including cell survival, cell proliferation, migration and differentiation. Ligand binding at the cell surface induces dimerization and autophosphorylation of AXL. Following activation by ligand, ALX binds and induces tyrosine phosphorylation of PI3-kinase subunits PIK3R1, PIK3R2 and PIK3R3; but also GRB2, PLCG1, LCK and PTPN11. Other downstream substrate candidates for AXL are CBL, NCK2, SOCS1 and TNS2. Recruitment of GRB2 and phosphatidylinositol 3 kinase regulatory subunits by AXL leads to the downstream activation of the AKT kinase. GAS6/AXL signaling plays a role in various processes such as endothelial cell survival during acidification by preventing apoptosis, optimal cytokine signaling during human natural killer cell development, hepatic regeneration, gonadotropin-releasing hormone neuron survival and migration, platelet activation, or regulation of thrombotic responses. Plays also an important role in inhibition of Toll-like receptors (TLRs)-mediated innate immune response.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.31 pg/mL

AXL Blocking Peptide

AF8412-BP 1mg
EUR 195

AXL Conjugated Antibody

C48205 100ul
EUR 397

Polyclonal AXL Antibody

APR05948G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AXL . This antibody is tested and proven to work in the following applications:

AXL Blocking Peptide

BF0290-BP 1mg
EUR 195

AXL Blocking Peptide

AF7793-BP 1mg
EUR 195

AXL cloning plasmid

CSB-CL326981HU-10ug 10ug
EUR 861
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2685
  • Sequence: atggcgtggcggtgccccaggatgggcagggtcccgctggcctggtgcttggcgctgtgcggctgggcgtgcatggcccccaggggcacgcaggctgaagaaagtcccttcgtgggcaacccagggaatatcacaggtgcccggggactcacgggcacccttcggtgtcagctcc
  • Show more
Description: A cloning plasmid for the AXL gene.

anti- AXL antibody

FNab00754 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IP: 1:500-1:2000
  • Immunogen: AXL receptor tyrosine kinase
  • Uniprot ID: P30530
  • Gene ID: 558
  • Research Area: Cancer, Immunology, Signal Transduction, Metabolism
Description: Antibody raised against AXL

Axl Polyclonal Antibody

ES6771-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Axl Polyclonal Antibody

ES6771-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Axl Polyclonal Antibody

ES8372-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Axl Polyclonal Antibody

ES8372-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Axl Polyclonal Antibody

ABP57379-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691

Axl Polyclonal Antibody

ABP57379-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691

Axl Polyclonal Antibody

ABP57379-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691

Axl Polyclonal Antibody

ABP55772-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697

Axl Polyclonal Antibody

ABP55772-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697

Axl Polyclonal Antibody

ABP55772-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697

AXL (pY691) Antibody

abx148474-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

AXL (pY702) Antibody

abx148475-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

AXL Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

AXL (pT697) Antibody

  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

AXL (pY691) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Anti-AXL Antibody

A00226-2 100ug/vial
EUR 294

AXL Rabbit pAb

A0532-100ul 100 ul
EUR 308

AXL Rabbit pAb

A0532-200ul 200 ul
EUR 459

AXL Rabbit pAb

A0532-20ul 20 ul Ask for price

AXL Rabbit pAb

A0532-50ul 50 ul Ask for price

AXL antibody (Tyr691)

70R-32634 100 ug
EUR 327
Description: Rabbit polyclonal AXL antibody (Tyr691)

AXL Rabbit pAb

A17874-100ul 100 ul
EUR 308

AXL Rabbit pAb

A17874-200ul 200 ul
EUR 459

AXL Rabbit pAb

A17874-20ul 20 ul
EUR 183

AXL Rabbit pAb

A17874-50ul 50 ul
EUR 223

AXL Blocking Peptide

33R-7673 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AXL antibody, catalog no. 70R-9655

Anti-AXL antibody

PAab00754 100 ug
EUR 355

anti-AXL (1B3A2)

LF-MA30204 100 ul
EUR 425
Description: Mouse Monoclonal to AXL

anti-AXL (7E10)

LF-MA30273 100 ul
EUR 486
Description: Mouse Monoclonal to AXL

pDONR223-AXL Plasmid

PVTB00185S 2 ug
EUR 356

Anti-Axl antibody

STJ91791 200 µl
EUR 197
Description: Rabbit polyclonal to Axl.

Anti-Axl antibody

STJ97643 200 µl
EUR 197
Description: Rabbit polyclonal to Axl.

Anti-Axl antibody

STJ97856 100 µl
EUR 234
Description: Mouse monoclonal to Axl.

Anti-Axl antibody

STJ97857 100 µl
EUR 234
Description: Mouse monoclonal to Axl.

Anti-Axl Antibody

STJ500198 100 µg
EUR 476

Anti-AXL antibody

STJ22748 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene.

Anti-AXL antibody

STJ119885 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene.

Anti-Axl (2C10)

YF-MA12092 100 ug
EUR 363
Description: Mouse monoclonal to Axl

Anti-AXL (6C8)

YF-MA10084 100 ug
EUR 363
Description: Mouse monoclonal to AXL

Anti-AXL (6G1)

YF-MA10085 100 ug
EUR 363
Description: Mouse monoclonal to AXL

Axl ORF Vector (Rat) (pORF)

ORF063895 1.0 ug DNA
EUR 506

Axl ORF Vector (Rat) (pORF)

ORF063896 1.0 ug DNA
EUR 506

Phospho-AXL (Tyr691) Antibody

AF8522 200ul
EUR 376
Description: AXL (Phospho-Tyr691) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr691.

Phospho-AXL (Tyr702) Antibody

AF8523 200ul
EUR 376
Description: AXL (Phospho-Tyr702) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr702.

Mouse AXL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-AXL (Tyr703) Antibody

AF7293 200ul
EUR 376
Description: Phospho-AXL (Tyr703) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr703.

AXL (pY697) Blocking Peptide

  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

AXL (Phospho- Tyr691) Antibody

ABF8522 100 ug
EUR 438

AXL (Phospho- Tyr702) Antibody

ABF8523 100 ug
EUR 438

Human AXL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AXL (phosphoY821) peptide

AB-23085-P 100ug
EUR 164

Rat AXL(AXL Receptor Tyrosine Kinase) ELISA Kit