Mouse EVL(Enah/Vasp Like Protein) ELISA Kit
To Order Contact us: [email protected]
Human Enah/Vasp Like Protein (EVL) ELISA Kit |
RDR-EVL-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Enah/Vasp Like Protein (EVL) ELISA Kit |
RDR-EVL-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Mouse Enah/Vasp Like Protein ELISA Kit (EVL) |
RK02774 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Enah/Vasp Like Protein (EVL) ELISA Kit |
SEQ820Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Enah/Vasp Like Protein (EVL) ELISA Kit |
SEQ820Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Enah/Vasp Like Protein (EVL) ELISA Kit |
SEQ820Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Enah/Vasp Like Protein (EVL) ELISA Kit |
SEQ820Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Enah/Vasp Like Protein (EVL) ELISA Kit |
4-SEQ820Mu |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Enah/Vasp Like Protein elisa. Alternative names of the recognized antigen: RNB6
- Enabled/Vasodilator Stimulated Phosphoprotein Like protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Enah/Vasp Like Protein (EVL) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Enah/Vasp Like Protein (EVL) Antibody |
20-abx112284 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Enah/Vasp Like Protein (EVL) Antibody |
20-abx172219 |
Abbexa |
|
|
|
Enah/Vasp Like Protein (EVL) Antibody |
20-abx176248 |
Abbexa |
|
|
|
Mouse Enah/Vasp Like Protein (EVL) CLIA Kit |
20-abx496551 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Enah/Vasp Like Protein (EVL) ELISA Kit |
20-abx151456 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Enah/Vasp Like Protein (EVL) ELISA Kit |
SEQ820Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids. |
Human Enah/Vasp Like Protein (EVL) ELISA Kit |
SEQ820Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids. |
Human Enah/Vasp Like Protein (EVL) ELISA Kit |
SEQ820Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids. |
Human Enah/Vasp Like Protein (EVL) ELISA Kit |
SEQ820Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids. |
Human Enah/Vasp Like Protein (EVL) ELISA Kit |
4-SEQ820Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Enah/Vasp Like Protein elisa. Alternative names of the recognized antigen: RNB6
- Enabled/Vasodilator Stimulated Phosphoprotein Like protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enah/Vasp Like Protein (EVL) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse EVL (Enah/Vasp Like Protein) |
ELK8263 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enah/Vasp Like Protein (EVL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Enah/
- Show more
|
Description: A sandwich ELISA kit for detection of Enah/Vasp Like Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Enah/Vasp Like Protein (EVL) Protein |
20-abx653258 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Enah/Vasp Like Protein (EVL) CLIA Kit |
20-abx496210 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human EVL (Enah/Vasp Like Protein) |
ELK6308 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enah/Vasp Like Protein (EVL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Enah/
- Show more
|
Description: A sandwich ELISA kit for detection of Enah/Vasp Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
anti-Enah/Vasp-like |
YF-PA26191 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Enah/Vasp-like |
Mouse Ena/VASP- like protein, Evl ELISA KIT |
ELI-09271m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Ena/VASP-Like Protein (EVL) ELISA Kit |
20-abx258850 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Evl ELISA Kit| Mouse Ena/VASP-like protein ELISA Kit |
EF014844 |
Lifescience Market |
96 Tests |
EUR 689 |
Anti-Enah/Vasp-like (5G1) |
YF-MA18517 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Enah/Vasp-like |
Anti-Enah/Vasp-like (1D6) |
YF-MA18518 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Enah/Vasp-like |
Human Ena/VASP- like protein, EVL ELISA KIT |
ELI-09270h |
Lifescience Market |
96 Tests |
EUR 824 |
Rat Ena/VASP-Like Protein (EVL) ELISA Kit |
abx391304-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Ena/VASP-Like Protein (EVL) Antibody |
20-abx215262 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ena/VASP-Like Protein (EVL) Antibody |
abx431235-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Ena/VASP-Like Protein (EVL) Antibody |
abx232887-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Evl ELISA Kit| Rat Ena/VASP-like protein ELISA Kit |
EF018659 |
Lifescience Market |
96 Tests |
EUR 689 |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
DLR-VASP-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
DLR-VASP-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
DLR-VASP-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
DLR-VASP-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
RDR-VASP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
RDR-VASP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
RDR-VASP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
RDR-VASP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
RD-VASP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
RD-VASP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
RD-VASP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
RD-VASP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
EVL ELISA Kit (Mouse) (OKCD09469) |
OKCD09469 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL |
Mouse Protein enabled homolog, Enah ELISA KIT |
ELI-26596m |
Lifescience Market |
96 Tests |
EUR 865 |
ENAH Recombinant Protein (Mouse) |
RP131696 |
ABM |
100 ug |
Ask for price |
ENAH Recombinant Protein (Mouse) |
RP131699 |
ABM |
100 ug |
Ask for price |
ENAH Recombinant Protein (Mouse) |
RP131702 |
ABM |
100 ug |
Ask for price |
ENAH Recombinant Protein (Mouse) |
RP131705 |
ABM |
100 ug |
Ask for price |
EVL Recombinant Protein (Mouse) |
RP132431 |
ABM |
100 ug |
Ask for price |
EVL Recombinant Protein (Mouse) |
RP132434 |
ABM |
100 ug |
Ask for price |
EVL Recombinant Protein (Mouse) |
RP132437 |
ABM |
100 ug |
Ask for price |
EVL Recombinant Protein (Mouse) |
RP132440 |
ABM |
100 ug |
Ask for price |
VASP ELISA Kit (Mouse) (OKCA02474) |
OKCA02474 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance, lamellipodial and filopodial dynamics, platelet activation and cell migration. VASP promotes actin filament elongation. It protects the barbed end of growing actin filaments against capping and increases the rate of actin polymerization in the presence of capping protein. VASP stimulates actin filament elongation by promoting the transfer of profilin-bound actin monomers onto the barbed end of growing actin filaments. Plays a role in actin-based mobility of Listeria monocytogenes in host cells. Regulates actin dynamics in platelets and plays an important role in regulating platelet aggregation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 1.56 pg/mL |
ENAH, Actin Regulator (ENAH) Antibody |
abx030898-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ENAH, Actin Regulator (ENAH) Antibody |
abx030898-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
ENAH, Actin Regulator (ENAH) Antibody |
20-abx328350 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ENAH, Actin Regulator (ENAH) Antibody |
20-abx215152 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EVL ELISA Kit (Human) (OKCD09468) |
OKCD09468 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells. EVL enhances actin nucleation and polymerization.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL |
EVL ELISA Kit (Human) (OKDD00257) |
OKDD00257 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells. EVL enhances actin nucleation and polymerization.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL |
VASP Recombinant Protein (Mouse) |
RP183659 |
ABM |
100 ug |
Ask for price |
Human Protein enabled homolog, ENAH ELISA KIT |
ELI-47054h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse ENAH shRNA Plasmid |
20-abx970170 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ENAH siRNA |
20-abx915387 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ENAH siRNA |
20-abx915388 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ENAH Antibody |
45263-100ul |
SAB |
100ul |
EUR 252 |
ENAH Antibody |
45263-50ul |
SAB |
50ul |
EUR 187 |
ENAH Antibody |
DF8286 |
Affbiotech |
200ul |
EUR 304 |
Description: ENAH Antibody detects endogenous levels of total ENAH. |
ENAH Antibody |
1-CSB-PA030227 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against ENAH. Recognizes ENAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
Mouse EVL shRNA Plasmid |
20-abx970242 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
EVL siRNA |
20-abx901794 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EVL siRNA |
20-abx915772 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EVL siRNA |
20-abx915773 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EVL Antibody |
45214-100ul |
SAB |
100ul |
EUR 252 |
EVL Antibody |
45214-50ul |
SAB |
50ul |
EUR 187 |
EVL antibody |
70R-17165 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EVL antibody |
EVL Antibody |
DF8091 |
Affbiotech |
200ul |
EUR 304 |
Description: EVL Antibody detects endogenous levels of total EVL. |
EVL Antibody |
1-CSB-PA007869GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against EVL. Recognizes EVL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Mouse Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit |
abx521219-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Vasodilator- stimulated phosphoprotein, Vasp ELISA KIT |
ELI-07733m |
Lifescience Market |
96 Tests |
EUR 865 |
ENAH Recombinant Protein (Human) |
RP010672 |
ABM |
100 ug |
Ask for price |
ENAH Recombinant Protein (Rat) |
RP199598 |
ABM |
100 ug |
Ask for price |
VASP ELISA Kit (Human) (OKCD08196) |
OKCD08196 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL |
VASP ELISA Kit (Rat) (OKDD00880) |
OKDD00880 |
Aviva Systems Biology |
96 Wells |
EUR 1040 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.052ng/mL |
VASP ELISA Kit (Bovine) (OKEH03950) |
OKEH03950 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance, lamellipodial and filopodial dynamics, platelet activation and cell migration. VASP promotes actin filament elongation. It protects the barbed end of growing actin filaments against capping and increases the rate of actin polymerization in the presence of capping protein. VASP stimulates actin filament elongation by promoting the transfer of profilin-bound actin monomers onto the barbed end of growing actin filaments. Plays a role in actin-based mobility of Listeria monocytogenes in host cells. Regulates actin dynamics in platelets and plays an important role in regulating platelet aggregation (By similarity);Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.091 ng/mL |
VASP ELISA Kit (Dog) (OKEH08783) |
OKEH08783 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
VASP ELISA Kit (Rat) (OKEI00887) |
OKEI00887 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance, lamellipodial and filopodial dynamics, platelet activation and cell migration.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
EVL Recombinant Protein (Human) |
RP011005 |
ABM |
100 ug |
Ask for price |
EVL Recombinant Protein (Human) |
RP011008 |
ABM |
100 ug |
Ask for price |
EVL Recombinant Protein (Rat) |
RP200054 |
ABM |
100 ug |
Ask for price |
Enah ORF Vector (Mouse) (pORF) |
ORF043900 |
ABM |
1.0 ug DNA |
EUR 506 |
Enah ORF Vector (Mouse) (pORF) |
ORF043901 |
ABM |
1.0 ug DNA |
EUR 506 |
Enah ORF Vector (Mouse) (pORF) |
ORF043902 |
ABM |
1.0 ug DNA |
EUR 506 |
Enah ORF Vector (Mouse) (pORF) |
ORF043903 |
ABM |
1.0 ug DNA |
EUR 506 |
ENAH Protein Vector (Mouse) (pPB-C-His) |
PV175598 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPB-N-His) |
PV175599 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPM-C-HA) |
PV175600 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPM-C-His) |
PV175601 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPB-C-His) |
PV175602 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPB-N-His) |
PV175603 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPM-C-HA) |
PV175604 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPM-C-His) |
PV175605 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPB-C-His) |
PV175606 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPB-N-His) |
PV175607 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPM-C-HA) |
PV175608 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPM-C-His) |
PV175609 |
ABM |
500 ng |
EUR 1065 |
ENAH Protein Vector (Mouse) (pPB-C-His) |
PV175610 |
ABM |
500 ng |
EUR 603 |
ENAH Protein Vector (Mouse) (pPB-N-His) |
PV175611 |
ABM |
500 ng |
EUR 603 |
ENAH Protein Vector (Mouse) (pPM-C-HA) |
PV175612 |
ABM |
500 ng |
EUR 603 |
ENAH Protein Vector (Mouse) (pPM-C-His) |
PV175613 |
ABM |
500 ng |
EUR 603 |
Evl ORF Vector (Mouse) (pORF) |
ORF044145 |
ABM |
1.0 ug DNA |
EUR 506 |
Evl ORF Vector (Mouse) (pORF) |
ORF044146 |
ABM |
1.0 ug DNA |
EUR 506 |
Evl ORF Vector (Mouse) (pORF) |
ORF044147 |
ABM |
1.0 ug DNA |
EUR 506 |
Evl ORF Vector (Mouse) (pORF) |
ORF044148 |
ABM |
1.0 ug DNA |
EUR 506 |
Vasp ELISA Kit| Mouse Vasodilator-stimulated phosphoprotein ELI |
EF016488 |
Lifescience Market |
96 Tests |
EUR 689 |
ENAH Conjugated Antibody |
C45263 |
SAB |
100ul |
EUR 397 |
ENAH Rabbit pAb |
A17932-100ul |
Abclonal |
100 ul |
EUR 308 |
ENAH Rabbit pAb |
A17932-200ul |
Abclonal |
200 ul |
EUR 459 |
ENAH Rabbit pAb |
A17932-20ul |
Abclonal |
20 ul |
EUR 183 |
ENAH Rabbit pAb |
A17932-50ul |
Abclonal |
50 ul |
EUR 223 |
ENAH cloning plasmid |
CSB-CL854072HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 441
- Sequence: atggaaattcaaagaagacaactacaagaacagcaacggcaaaaggagctggagcgggaaaggctggagcgagaaagaatggaaagagaaaggttggagagagagaggttagaaagggaaaggctggagagggagcgactggaacaagaacagctggagagagagagacaagaacg
- Show more
|
Description: A cloning plasmid for the ENAH gene. |
ENAH Blocking Peptide |
DF8286-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-ENAH (3E6) |
YF-MA18819 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ENAH |
EVL Protein Vector (Mouse) (pPB-C-His) |
PV176578 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPB-N-His) |
PV176579 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPM-C-HA) |
PV176580 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPM-C-His) |
PV176581 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPB-C-His) |
PV176582 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPB-N-His) |
PV176583 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPM-C-HA) |
PV176584 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPM-C-His) |
PV176585 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPB-C-His) |
PV176586 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPB-N-His) |
PV176587 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPM-C-HA) |
PV176588 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPM-C-His) |
PV176589 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPB-C-His) |
PV176590 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPB-N-His) |
PV176591 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPM-C-HA) |
PV176592 |
ABM |
500 ng |
EUR 603 |
EVL Protein Vector (Mouse) (pPM-C-His) |
PV176593 |
ABM |
500 ng |
EUR 603 |
Mouse VASP shRNA Plasmid |
20-abx973348 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
EVL Conjugated Antibody |
C45214 |
SAB |
100ul |
EUR 397 |
anti- EVL antibody |
FNab02887 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: Enah/Vasp-like
- Uniprot ID: Q9UI08
- Gene ID: 51466
- Research Area: Signal Transduction, Developmental biology
|
Description: Antibody raised against EVL |
EVL Blocking Peptide |
DF8091-BP |
Affbiotech |
1mg |
EUR 195 |
EVL cloning plasmid |
CSB-CL887052HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1257
- Sequence: atggccacaagtgaacagagtatctgccaagcccgggcttccgtgatggtctacgatgacaccagtaagaaatgggtaccaatcaaacctggccagcagggattcagccggatcaacatctaccacaacactgccagcaacaccttcagagtcgttggagtcaagttgcaggatc
- Show more
|
Description: A cloning plasmid for the EVL gene. |
EVL cloning plasmid |
CSB-CL887052HU2-10ug |
Cusabio |
10ug |
EUR 460 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1251
- Sequence: atgagtgaacagagtatctgccaagcccgggcttccgtgatggtctacgatgacaccagtaagaaatgggtaccaatcaaacctggccagcagggattcagccggatcaacatctaccacaacactgccagcaacaccttcagagtcgttggagtcaagttgcaggatcagcagg
- Show more
|
Description: A cloning plasmid for the EVL gene. |
Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
abx595616-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
VASP Colorimetric Cell-Based ELISA Kit |
EKC1588 |
BosterBio |
100ul |
EUR 572 |
VASP Antibody |
AF6337 |
Affbiotech |
200ul |
EUR 304 |
Description: VASP Antibody detects endogenous levels of total VASP. |
VASP Antibody |
AF6338 |
Affbiotech |
200ul |
EUR 304 |
Description: VASP Antibody detects endogenous levels of total VASP. |
VASP siRNA |
20-abx939342 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VASP siRNA |
20-abx939343 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VASP antibody |
70R-50533 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal VASP antibody |
VASP antibody |
70R-50534 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal VASP antibody |
VASP antibody |
70R-51671 |
Fitzgerald |
100 ul |
EUR 287 |
Description: Purified Polyclonal VASP antibody |
VASP antibody |
70R-34661 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified Rabbit polyclonal VASP antibody |
VASP antibody |
70R-21241 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal VASP antibody |
VASP antibody |
70R-31071 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal VASP antibody |
VASP Antibody |
48793-100ul |
SAB |
100ul |
EUR 333 |
VASP Antibody |
48793-50ul |
SAB |
50ul |
EUR 239 |
VASP antibody |
10R-6259 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal VASP antibody |
VASP antibody |
10R-6261 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal VASP antibody |
VASP antibody |
10R-6262 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal VASP antibody |
VASP antibody |
10R-7236 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal VASP antibody |
VASP antibody |
20R-1715 |
Fitzgerald |
100 ug |
EUR 716 |
Description: Rabbit polyclonal VASP antibody |
VASP antibody |
20R-2008 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal VASP antibody |
VASP antibody |
20R-2056 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal VASP antibody |
VASP antibody |
20R-2339 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal VASP antibody |
VASP antibody |
20R-2370 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal VASP antibody |
VASP antibody |
70R-12030 |
Fitzgerald |
100 ug |
EUR 403 |
Description: Rabbit polyclonal VASP antibody |
VASP antibody |
70R-10267 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal VASP antibody |
VASP antibody |
70R-10268 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal VASP antibody |
VASP Antibody |
1-CSB-PA004422 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
VASP Antibody |
1-CSB-PA004424 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
VASP Antibody |
1-CSB-PA010556 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000 |
VASP Antibody |
1-CSB-PA060049 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000 |
VASP Antibody |
1-CSB-PA025797GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
anti-VASP |
YF-PA15255 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to VASP |
anti-VASP |
YF-PA15256 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to VASP |
Enah sgRNA CRISPR Lentivector set (Mouse) |
K5028201 |
ABM |
3 x 1.0 ug |
EUR 339 |
VASP protein (His tag) |
80R-1761 |
Fitzgerald |
50 ug |
EUR 397 |
Description: Purified recombinant Human VASP protein |
VASP Recombinant Protein (Human) |
RP034258 |
ABM |
100 ug |
Ask for price |
VASP Recombinant Protein (Human) |
RP034261 |
ABM |
100 ug |
Ask for price |
VASP Recombinant Protein (Rat) |
RP236285 |
ABM |
100 ug |
Ask for price |
Evl sgRNA CRISPR Lentivector set (Mouse) |
K3246001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Human ENAH shRNA Plasmid |
20-abx960877 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VASP Protein Vector (Mouse) (pPB-C-His) |
PV244882 |
ABM |
500 ng |
EUR 603 |
VASP Protein Vector (Mouse) (pPB-N-His) |
PV244883 |
ABM |
500 ng |
EUR 603 |
VASP Protein Vector (Mouse) (pPM-C-HA) |
PV244884 |
ABM |
500 ng |
EUR 603 |
VASP Protein Vector (Mouse) (pPM-C-His) |
PV244885 |
ABM |
500 ng |
EUR 603 |
Vasp ORF Vector (Mouse) (pORF) |
ORF061221 |
ABM |
1.0 ug DNA |
EUR 506 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Cow Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit |
abx521216-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Dog Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit |
abx521217-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
abx570947-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
abx571896-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Bovine VASP/ Vasodilator-stimulated phosphoprotein ELISA Kit |
E0281Bo |
Sunlong |
1 Kit |
EUR 717 |
Human VASP/ Vasodilator-stimulated phosphoprotein ELISA Kit |
E2652Hu |
Sunlong |
1 Kit |
EUR 605 |
Human VASP(Vasodilator-stimulated phosphoprotein) ELISA Kit |
EH2489 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P50552
- Alias: VASP
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Canine Vasodilator-stimulated phosphoprotein, VASP ELISA KIT |
ELI-07731d |
Lifescience Market |
96 Tests |
EUR 928 |
Human Vasodilator- stimulated phosphoprotein, VASP ELISA KIT |
ELI-07732h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Vasodilator- stimulated phosphoprotein, VASP ELISA KIT |
ELI-07734b |
Lifescience Market |
96 Tests |
EUR 928 |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
20-abx156215 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
20-abx153458 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
abx251857-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Vasodilator-stimulated phosphoprotein(VASP) ELISA kit |
CSB-EL025797HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Vasodilator-stimulated phosphoprotein(VASP) ELISA kit |
1-CSB-EL025797HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Vasodilator-stimulated phosphoprotein(VASP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
SEC603Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
SEC603Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
SEC603Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
SEC603Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
4-SEC603Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Vasodilator Stimulated Phosphoprotein elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
SEC603Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
SEC603Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
SEC603Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
SEC603Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
4-SEC603Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Vasodilator Stimulated Phosphoprotein elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Vasodilator Stimulated Phosphoprotein ELISA Kit (VASP) |
RK04016 |
Abclonal |
96 Tests |
EUR 521 |
Human Vasodilator Stimulated Phosphoprotein(VASP)ELISA Kit |
QY-E00688 |
Qayee Biotechnology |
96T |
EUR 361 |
VASP Colorimetric Cell-Based ELISA Kit (OKAG01105) |
OKAG01105 |
Aviva Systems Biology |
96 Wells |
EUR 596 |
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity: |
VASP ELISA Kit (Human) : 96 Wells (OKEH01980) |
OKEH01980 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Rat EVL shRNA Plasmid |
20-abx986496 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse EVL(Enah/Vasp Like Protein) ELISA Kit