Human RPL23A(Ribosomal Protein L23A) ELISA Kit

Human RPL23A(Ribosomal Protein L23A) ELISA Kit

To Order Contact us: [email protected]

Human Ribosomal Protein L23A (RPL23A) ELISA Kit

RDR-RPL23A-Hu-48Tests 48 Tests
EUR 589

Human Ribosomal Protein L23A (RPL23A) ELISA Kit

RDR-RPL23A-Hu-96Tests 96 Tests
EUR 820

Human Ribosomal Protein L23A (RPL23A) ELISA Kit

RD-RPL23A-Hu-48Tests 48 Tests
EUR 563

Human Ribosomal Protein L23A (RPL23A) ELISA Kit

RD-RPL23A-Hu-96Tests 96 Tests
EUR 783

Ribosomal Protein L23A (RPL23A) ELISA Kit

20-abx258198
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribosomal Protein L23A(RPL23A)ELISA Kit

QY-E03157 96T
EUR 361

Ribosomal Protein L23A (RPL23A) Antibody

20-abx003006
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody

20-abx115233
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody

20-abx130536
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribosomal Protein L23A (RPL23A) Antibody

20-abx174421
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ribosomal Protein L23A (RPL23A) Antibody

abx030993-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody

abx030993-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody

20-abx318868
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody

abx237423-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Ribosomal Protein L23A (RPL23A)

4-RPP643Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62750
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Ribosomal Protein L23A expressed in: E.coli

Human Ribosomal Protein L23A (RPL23A) Protein

20-abx650816
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribosomal Protein L23A (RPL23A) CLIA Kit

20-abx496129
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human 60S ribosomal protein L23a(RPL23A) ELISA kit

E01R0444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L23a(RPL23A) ELISA kit

E01R0444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L23a(RPL23A) ELISA kit

E01R0444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L23a, RPL23A ELISA KIT

ELI-22033h 96 Tests
EUR 824

ELISA kit for Human RPL23A (Ribosomal Protein L23A)

ELK8123 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribosomal Protein L23A (RPL23A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ri
  • Show more
Description: A sandwich ELISA kit for detection of Ribosomal Protein L23A from Human,Mouse,Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RPL23A Ribosomal Protein L23A Human Recombinant Protein

PROTP62750 Regular: 10ug
EUR 317
Description: RPL23A Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (1-156 a.a) and having a molecular mass of 20.1kDa.

Ribosomal Protein L23A (RPL23A) Antibody (HRP)

20-abx317177
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody (FITC)

20-abx317178
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody (Biotin)

20-abx317179
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rabbit 60S ribosomal protein L23a(RPL23A) ELISA kit

E04R0444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L23a(RPL23A) ELISA kit

E04R0444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L23a(RPL23A) ELISA kit

E04R0444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23a(RPL23A) ELISA kit

E02R0444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23a(RPL23A) ELISA kit

E02R0444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23a(RPL23A) ELISA kit

E02R0444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L23a(RPL23A) ELISA kit

E03R0444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L23a(RPL23A) ELISA kit

E03R0444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L23a(RPL23A) ELISA kit

E03R0444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L23a(RPL23A) ELISA kit

E06R0444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L23a(RPL23A) ELISA kit

E06R0444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L23a(RPL23A) ELISA kit

E06R0444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L23a(RPL23A) ELISA kit

E08R0444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L23a(RPL23A) ELISA kit

E08R0444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L23a(RPL23A) ELISA kit

E08R0444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L23a(RPL23A) ELISA kit

E07R0444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L23a(RPL23A) ELISA kit

E07R0444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L23a(RPL23A) ELISA kit

E07R0444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 60S ribosomal protein L23a(RPL23A) ELISA kit

E09R0444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 60S ribosomal protein L23a(RPL23A) ELISA kit

E09R0444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 60S ribosomal protein L23a(RPL23A) ELISA kit

E09R0444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine 60S ribosomal protein L23a, RPL23A ELISA KIT

ELI-30297b 96 Tests
EUR 928

Mouse 60S ribosomal protein L23a, Rpl23a ELISA KIT

ELI-42597m 96 Tests
EUR 865

Multi-species Ribosomal Protein L23A (RPL23A) ELISA Kit

SEP643Mi-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Ribosomal Protein L23A (RPL23A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Ribosomal Protein L23A (RPL23A) in Tissue homogenates, cell lysates and other biological fluids.

Multi-species Ribosomal Protein L23A (RPL23A) ELISA Kit

SEP643Mi-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Ribosomal Protein L23A (RPL23A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Ribosomal Protein L23A (RPL23A) in Tissue homogenates, cell lysates and other biological fluids.

Multi-species Ribosomal Protein L23A (RPL23A) ELISA Kit

SEP643Mi-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Ribosomal Protein L23A (RPL23A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Ribosomal Protein L23A (RPL23A) in Tissue homogenates, cell lysates and other biological fluids.

Multi-species Ribosomal Protein L23A (RPL23A) ELISA Kit

SEP643Mi-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Ribosomal Protein L23A (RPL23A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Ribosomal Protein L23A (RPL23A) in Tissue homogenates, cell lysates and other biological fluids.

Multi-species Ribosomal Protein L23A (RPL23A) ELISA Kit

4-SEP643Mi
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribosomal Protein L23A elisa. Alternative names of the recognized antigen: 60S ribosomal protein L23a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Multi-species Ribosomal Protein L23A (RPL23A) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human)

4-PAP643Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPL23A (Ala2~Ile156)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A)

Guinea pig 60S ribosomal protein L23a(RPL23A) ELISA kit

E05R0444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 60S ribosomal protein L23a(RPL23A) ELISA kit

E05R0444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 60S ribosomal protein L23a(RPL23A) ELISA kit

E05R0444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), APC

4-PAP643Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPL23A (Ala2~Ile156)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with APC.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), Biotinylated

4-PAP643Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPL23A (Ala2~Ile156)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with Biotin.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), Cy3

4-PAP643Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPL23A (Ala2~Ile156)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with Cy3.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), FITC

4-PAP643Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPL23A (Ala2~Ile156)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with FITC.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), HRP

4-PAP643Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPL23A (Ala2~Ile156)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with HRP.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), PE

4-PAP643Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPL23A (Ala2~Ile156)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with PE.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), APC-Cy7

4-PAP643Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPL23A (Ala2~Ile156)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with APC-Cy7.

Ribosomal Protein L23A Protein

20-abx262616
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Rpl23a/ Rat Rpl23a ELISA Kit

ELI-14430r 96 Tests
EUR 886

RPL23A ELISA KIT|Human

EF002580 96 Tests
EUR 689

RPL23A Recombinant Protein (Human)

RP026908 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

RPL23A antibody

70R-10400 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RPL23A antibody

RPL23A antibody

70R-19972 50 ul
EUR 435
Description: Rabbit polyclonal RPL23A antibody

RPL23A Antibody

47280-100ul 100ul
EUR 252

RPL23A Antibody

1-CSB-PA020187GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL23A. Recognizes RPL23A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL23A Antibody

1-CSB-PA020187LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL23A. Recognizes RPL23A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

RPL23A siRNA

20-abx904654
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL23A siRNA

20-abx931937
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL23A siRNA

20-abx931938
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL23A protein (His tag)

80R-2807 50 ug
EUR 424
Description: Purified recombinant RPL23A protein (His tag)

RPL23A Recombinant Protein (Mouse)

RP169004 100 ug Ask for price

RPL23A Recombinant Protein (Rat)

RP226640 100 ug Ask for price

Human RPL23A shRNA Plasmid

20-abx954136
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

[One Step] RPL23A Antibody Kit

RK05699 50 ul
EUR 240

Human Ribosomal Protein L10 ELISA kit

E01R0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L10 ELISA kit

E01R0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L10 ELISA kit

E01R0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L26 ELISA kit

E01R0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L26 ELISA kit

E01R0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L26 ELISA kit

E01R0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein S19 ELISA kit

E01R0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein S19 ELISA kit

E01R0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein S19 ELISA kit

E01R0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ribosomal protein L4 ELISA KIT|Human

EF002461 96 Tests
EUR 689

RPL23A Blocking Peptide

33R-9529 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL23A antibody, catalog no. 70R-10400

RPL23A Conjugated Antibody

C47280 100ul
EUR 397

RPL23A cloning plasmid

CSB-CL020187HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 471
  • Sequence: atggcgccgaaagcgaagaaggaagctcctgcccctcctaaagctgaagccaaagcgaaggctttaaaggccaagaaggcagtgttgaaaggtgtccacagccacaaaaagaagaagatccgcacgtcacccaccttccggcggccgaagacactgcgactccggagacagcccaa
  • Show more
Description: A cloning plasmid for the RPL23A gene.

RPL23A Rabbit pAb

A4086-100ul 100 ul
EUR 308

RPL23A Rabbit pAb

A4086-200ul 200 ul
EUR 459

RPL23A Rabbit pAb

A4086-20ul 20 ul
EUR 183

RPL23A Rabbit pAb

A4086-50ul 50 ul
EUR 223

anti- RPL23A antibody

FNab07423 100µg
EUR 548.75
  • Immunogen: ribosomal protein L23a
  • Uniprot ID: P62750
  • Gene ID: 6147
  • Research Area: Metabolism
Description: Antibody raised against RPL23A

Anti-RPL23A antibody

PAab07423 100 ug
EUR 386

Anti-RPL23A antibody

STJ25395 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins. It is located in the cytoplasm. The protein may be one of the target molecules involved in mediating growth inhibition by interferon. In yeast, the corresponding protein binds to a specific site on the 26S rRNA. This gene is co-transcribed with the U42A, U42B, U101A, and U101B small nucleolar RNA genes, which are located in its third, first, second, and fourth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL23A (3E11)

YF-MA15244 100 ug
EUR 363
Description: Mouse monoclonal to RPL23A

RPL23A ORF Vector (Human) (pORF)

ORF008970 1.0 ug DNA
EUR 95

RPL23A Protein Vector (Human) (pPB-C-His)

PV035877 500 ng
EUR 329

RPL23A Protein Vector (Human) (pPB-N-His)

PV035878 500 ng
EUR 329

RPL23A Protein Vector (Human) (pPM-C-HA)

PV035879 500 ng
EUR 329

RPL23A Protein Vector (Human) (pPM-C-His)

PV035880 500 ng
EUR 329

Recombinant Human RPL23A Protein, His, E.coli-10ug

QP13344-10ug 10ug
EUR 201

Recombinant Human RPL23A Protein, His, E.coli-1mg

QP13344-1mg 1mg
EUR 5251

Recombinant Human RPL23A Protein, His, E.coli-2ug

QP13344-2ug 2ug
EUR 155

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

DLR-RPL13A-Hu-48T 48T
EUR 554
  • Should the Human Ribosomal Protein L13A (RPL13A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L13A (RPL13A) in samples from tissue homogenates or other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

DLR-RPL13A-Hu-96T 96T
EUR 725
  • Should the Human Ribosomal Protein L13A (RPL13A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L13A (RPL13A) in samples from tissue homogenates or other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

DLR-RPL6-Hu-48T 48T
EUR 517
  • Should the Human Ribosomal Protein L6 (RPL6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L6 (RPL6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

DLR-RPL6-Hu-96T 96T
EUR 673
  • Should the Human Ribosomal Protein L6 (RPL6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L6 (RPL6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Mitochondrial Ribosomal Protein L17 ELISA kit

E01M0227-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial Ribosomal Protein L17 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial Ribosomal Protein L17 ELISA kit

E01M0227-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial Ribosomal Protein L17 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial Ribosomal Protein L17 ELISA kit

E01M0227-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial Ribosomal Protein L17 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

20-abx152972
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

20-abx152982
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribosomal Protein S9 (RPS9) ELISA Kit

20-abx258583
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribosomal Protein L4 (RPL4) ELISA Kit

abx259815-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L13 (RPL13) ELISA Kit

abx251672-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human RPS19(Ribosomal protein S19) ELISA Kit

EH11973 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Ribosomal Protein L26 (RPL26) ELISA Kit

abx351725-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Ribosomal Protein L10 (RPL10) ELISA Kit

abx382895-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Ribosomal Protein L10A (RPL10A) ELISA Kit

abx382896-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L11 (RPL11) ELISA Kit

abx382897-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L12 (RPL12) ELISA Kit

abx382898-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L14 (RPL14) ELISA Kit

abx382900-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L15 (RPL15) ELISA Kit

abx382901-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L17 (RPL17) ELISA Kit

abx382902-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L18A (RPL18A) ELISA Kit

abx382903-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L19 (RPL19) ELISA Kit

abx382904-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L21 (RPL21) ELISA Kit

abx382905-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L22 (RPL22) ELISA Kit

abx382906-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L23 (RPL23) ELISA Kit

abx382907-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L24 (RPL24) ELISA Kit

abx382909-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L27 (RPL27) ELISA Kit

abx382911-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L27A (RPL27A) ELISA Kit

abx382912-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L28 (RPL28) ELISA Kit

abx382913-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L3 (RPL3) ELISA Kit

abx382914-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L30 (RPL30) ELISA Kit

abx382915-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L31 (RPL31) ELISA Kit

abx382916-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L32 (RPL32) ELISA Kit

abx382917-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L35 (RPL35) ELISA Kit

abx382918-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L37a (RPL37A) ELISA Kit

abx382920-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L38 (RPL38) ELISA Kit

abx382921-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L39 (RPL39) ELISA Kit

abx382922-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L5 (RPL5) ELISA Kit

abx382924-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L7 (RPL7) ELISA Kit

abx382926-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L7a (RPL7A) ELISA Kit

abx382927-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L8 (RPL8) ELISA Kit

abx382929-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L9 (RPL9) ELISA Kit

abx382930-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S10 (RPS10) ELISA Kit

abx382940-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S12 (RPS12) ELISA Kit

abx382941-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S16 (RPS16) ELISA Kit

abx382944-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S19 (RPS19) ELISA Kit

20-abx382945
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Ribosomal Protein S20 (RPS20) ELISA Kit

abx382946-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S21 (RPS21) ELISA Kit

abx382947-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S24 (RPS24) ELISA Kit

abx382948-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S26 (RPS26) ELISA Kit

abx382950-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S27 (RPS27) ELISA Kit

abx382951-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S28 (RPS28) ELISA Kit

abx382953-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S29 (RPS29) ELISA Kit

abx382954-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S3 (RPS3) ELISA Kit

abx382955-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S3A (RPS3A) ELISA Kit

abx382956-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S5 (RPS5) ELISA Kit

abx382959-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S6 (RPS6) ELISA Kit

abx382960-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S7 (RPS7) ELISA Kit

abx382962-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S8 (RPS8) ELISA Kit

abx382963-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S13 (RPS13) ELISA Kit

20-abx585091
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Ribosomal Protein S25 (RPS25) ELISA Kit

20-abx585301
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Ribosomal Protein S15 (RPS15) ELISA Kit

abx520475-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Ribosomal Protein L6(RPL6)ELISA Kit

QY-E03156 96T
EUR 361

Human Ribosomal Protein S9 (RPS9) ELISA Kit

SEF039Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit

SEF039Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit

SEF039Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit

SEF039Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit

4-SEF039Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribosomal Protein S9 elisa. Alternative names of the recognized antigen: 40S Ribosomal Protein S9
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribosomal Protein S9 (RPS9) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

SEF046Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

SEF046Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

SEF046Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

SEF046Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

4-SEF046Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribosomal Protein L6 elisa. Alternative names of the recognized antigen: SHUJUN-2
  • TAXREB107
  • TXREB1
  • Neoplasm-related protein C140
  • Tax-responsive enhancer element-binding protein 107
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribosomal Protein L6 (RPL6) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RDR-RPL13A-Hu-48Tests 48 Tests
EUR 589

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RDR-RPL13A-Hu-96Tests 96 Tests
EUR 820

Human Ribosomal Protein L6 (RPL6) ELISA Kit

RDR-RPL6-Hu-48Tests 48 Tests
EUR 544

Human Ribosomal Protein L6 (RPL6) ELISA Kit

RDR-RPL6-Hu-96Tests 96 Tests
EUR 756

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RD-RPL13A-Hu-48Tests 48 Tests
EUR 563

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RD-RPL13A-Hu-96Tests 96 Tests
EUR 783

Human Ribosomal Protein L6 (RPL6) ELISA Kit

RD-RPL6-Hu-48Tests 48 Tests
EUR 521

Human Ribosomal Protein L6 (RPL6) ELISA Kit

RD-RPL6-Hu-96Tests 96 Tests
EUR 723

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

SEQ321Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

SEQ321Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

SEQ321Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

SEQ321Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

4-SEQ321Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribosomal Protein L13A elisa. Alternative names of the recognized antigen: TSTA1
  • Tissue Specific Transplantation Antigen 1
  • 60S ribosomal protein L13a
  • 23 kDa highly basic protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribosomal Protein L13A (RPL13A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat RPL23A shRNA Plasmid

20-abx990060
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL23A Antibody, HRP conjugated

1-CSB-PA020187LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL23A. Recognizes RPL23A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL23A Antibody, FITC conjugated

1-CSB-PA020187LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL23A. Recognizes RPL23A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL23A Antibody, Biotin conjugated

1-CSB-PA020187LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL23A. Recognizes RPL23A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse RPL23A shRNA Plasmid

20-abx982954
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL23A sgRNA CRISPR Lentivector set (Human)

K1938401 3 x 1.0 ug
EUR 339

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Rabbit Ribosomal Protein L10 ELISA kit

E04R0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein L10 ELISA kit

E04R0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein L10 ELISA kit

E04R0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein L26 ELISA kit

E04R0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein L26 ELISA kit

E04R0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein L26 ELISA kit

E04R0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein S19 ELISA kit

E04R0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein S19 ELISA kit

E04R0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein S19 ELISA kit

E04R0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L10 ELISA kit

E02R0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L10 ELISA kit

E02R0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L10 ELISA kit

E02R0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L26 ELISA kit

E02R0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L26 ELISA kit

E02R0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L26 ELISA kit

E02R0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein S19 ELISA kit

E02R0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein S19 ELISA kit

E02R0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein S19 ELISA kit

E02R0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L10 ELISA kit

E03R0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L10 ELISA kit

E03R0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L10 ELISA kit

E03R0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L26 ELISA kit

E03R0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L26 ELISA kit

E03R0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L26 ELISA kit

E03R0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein S19 ELISA kit

E03R0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein S19 ELISA kit

E03R0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein S19 ELISA kit

E03R0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RPL23A(Ribosomal Protein L23A) ELISA Kit