Human RPL23A(Ribosomal Protein L23A) ELISA Kit

Human RPL23A(Ribosomal Protein L23A) ELISA Kit

To Order Contact us: [email protected]

Human Ribosomal Protein L23A (RPL23A) ELISA Kit
RDR-RPL23A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Ribosomal Protein L23A (RPL23A) ELISA Kit
RDR-RPL23A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Ribosomal Protein L23A (RPL23A) ELISA Kit
RD-RPL23A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Ribosomal Protein L23A (RPL23A) ELISA Kit
RD-RPL23A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Ribosomal Protein L23A (RPL23A) ELISA Kit
20-abx258198	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Ribosomal Protein L23A(RPL23A)ELISA Kit
QY-E03157	Qayee Biotechnology	96T	EUR 361

Ribosomal Protein L23A (RPL23A) Antibody
20-abx003006	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody
20-abx115233	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody
20-abx130536	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ribosomal Protein L23A (RPL23A) Antibody
20-abx174421	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Ribosomal Protein L23A (RPL23A) Antibody
abx030993-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody
abx030993-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody
20-abx318868	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody
abx237423-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Ribosomal Protein L23A (RPL23A)
4-RPP643Hu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P62750 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.3kDa Isoelectric Point: Inquire
Description: Recombinant Human Ribosomal Protein L23A expressed in: E.coli

Human Ribosomal Protein L23A (RPL23A) Protein
20-abx650816	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ribosomal Protein L23A (RPL23A) CLIA Kit
20-abx496129	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human 60S ribosomal protein L23a(RPL23A) ELISA kit
E01R0444-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L23a(RPL23A) ELISA kit
E01R0444-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L23a(RPL23A) ELISA kit
E01R0444-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L23a, RPL23A ELISA KIT
ELI-22033h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human RPL23A (Ribosomal Protein L23A)
ELK8123	ELK Biotech	1 plate of 96 wells	EUR 372
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribosomal Protein L23A (RPL23A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ri Show more
Description: A sandwich ELISA kit for detection of Ribosomal Protein L23A from Human,Mouse,Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RPL23A Ribosomal Protein L23A Human Recombinant Protein
PROTP62750	BosterBio	Regular: 10ug	EUR 317
Description: RPL23A Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (1-156 a.a) and having a molecular mass of 20.1kDa.

Ribosomal Protein L23A (RPL23A) Antibody (HRP)
20-abx317177	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody (FITC)
20-abx317178	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L23A (RPL23A) Antibody (Biotin)
20-abx317179	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rabbit 60S ribosomal protein L23a(RPL23A) ELISA kit
E04R0444-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L23a(RPL23A) ELISA kit
E04R0444-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L23a(RPL23A) ELISA kit
E04R0444-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23a(RPL23A) ELISA kit
E02R0444-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23a(RPL23A) ELISA kit
E02R0444-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23a(RPL23A) ELISA kit
E02R0444-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L23a(RPL23A) ELISA kit
E03R0444-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L23a(RPL23A) ELISA kit
E03R0444-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L23a(RPL23A) ELISA kit
E03R0444-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L23a(RPL23A) ELISA kit
E06R0444-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L23a(RPL23A) ELISA kit
E06R0444-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L23a(RPL23A) ELISA kit
E06R0444-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L23a(RPL23A) ELISA kit
E08R0444-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L23a(RPL23A) ELISA kit
E08R0444-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L23a(RPL23A) ELISA kit
E08R0444-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L23a(RPL23A) ELISA kit
E07R0444-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L23a(RPL23A) ELISA kit
E07R0444-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L23a(RPL23A) ELISA kit
E07R0444-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 60S ribosomal protein L23a(RPL23A) ELISA kit
E09R0444-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 60S ribosomal protein L23a(RPL23A) ELISA kit
E09R0444-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 60S ribosomal protein L23a(RPL23A) ELISA kit
E09R0444-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine 60S ribosomal protein L23a, RPL23A ELISA KIT
ELI-30297b	Lifescience Market	96 Tests	EUR 928

Mouse 60S ribosomal protein L23a, Rpl23a ELISA KIT
ELI-42597m	Lifescience Market	96 Tests	EUR 865

Multi-species Ribosomal Protein L23A (RPL23A) ELISA Kit
SEP643Mi-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5333.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Ribosomal Protein L23A (RPL23A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Ribosomal Protein L23A (RPL23A) in Tissue homogenates, cell lysates and other biological fluids.

Multi-species Ribosomal Protein L23A (RPL23A) ELISA Kit
SEP643Mi-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 526.89
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Ribosomal Protein L23A (RPL23A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Ribosomal Protein L23A (RPL23A) in Tissue homogenates, cell lysates and other biological fluids.

Multi-species Ribosomal Protein L23A (RPL23A) ELISA Kit
SEP643Mi-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 709.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Ribosomal Protein L23A (RPL23A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Ribosomal Protein L23A (RPL23A) in Tissue homogenates, cell lysates and other biological fluids.

Multi-species Ribosomal Protein L23A (RPL23A) ELISA Kit
SEP643Mi-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2894.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Ribosomal Protein L23A (RPL23A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Ribosomal Protein L23A (RPL23A) in Tissue homogenates, cell lysates and other biological fluids.

Multi-species Ribosomal Protein L23A (RPL23A) ELISA Kit
4-SEP643Mi	Cloud-Clone	EUR 5384.00 EUR 2845.00 EUR 710.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Ribosomal Protein L23A elisa. Alternative names of the recognized antigen: 60S ribosomal protein L23a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Multi-species Ribosomal Protein L23A (RPL23A) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human)
4-PAP643Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPL23A (Ala2~Ile156) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A)

Guinea pig 60S ribosomal protein L23a(RPL23A) ELISA kit
E05R0444-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 60S ribosomal protein L23a(RPL23A) ELISA kit
E05R0444-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 60S ribosomal protein L23a(RPL23A) ELISA kit
E05R0444-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 60S ribosomal protein L23a(RPL23A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), APC
4-PAP643Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPL23A (Ala2~Ile156) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with APC.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), Biotinylated
4-PAP643Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPL23A (Ala2~Ile156) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with Biotin.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), Cy3
4-PAP643Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPL23A (Ala2~Ile156) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with Cy3.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), FITC
4-PAP643Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPL23A (Ala2~Ile156) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with FITC.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), HRP
4-PAP643Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPL23A (Ala2~Ile156) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with HRP.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), PE
4-PAP643Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPL23A (Ala2~Ile156) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with PE.

Ribosomal Protein L23A (RPL23A) Polyclonal Antibody (Human), APC-Cy7
4-PAP643Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPL23A (Ala2~Ile156) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribosomal Protein L23A (RPL23A). This antibody is labeled with APC-Cy7.

Ribosomal Protein L23A Protein
20-abx262616	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Rpl23a/ Rat Rpl23a ELISA Kit
ELI-14430r	Lifescience Market	96 Tests	EUR 886

RPL23A ELISA KIT|Human
EF002580	Lifescience Market	96 Tests	EUR 689

RPL23A ELISA Kit (Human) (OKDD00511)
OKDD00511	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins. It is located in the cytoplasm. The protein may be one of the target molecules involved in mediating growth inhibition by interferon. In yeast, the corresponding protein binds to a specific site on the 26S rRNA. This gene is co-transcribed with the U42A, U42B, U101A, and U101B small nucleolar RNA genes, which are located in its third, first, second, and fourth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.058 ng/mL

RPL23A Recombinant Protein (Human)
RP026908	ABM	100 ug	Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

RPL23A antibody
70R-10400	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal RPL23A antibody

RPL23A antibody
70R-19972	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPL23A antibody

RPL23A Antibody
47280-100ul	SAB	100ul	EUR 252

RPL23A Antibody
1-CSB-PA020187GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL23A. Recognizes RPL23A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL23A Antibody
1-CSB-PA020187LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL23A. Recognizes RPL23A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

RPL23A siRNA
20-abx904654	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL23A siRNA
20-abx931937	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL23A siRNA
20-abx931938	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL23A protein (His tag)
80R-2807	Fitzgerald	50 ug	EUR 424
Description: Purified recombinant RPL23A protein (His tag)

RPL23A Recombinant Protein (Mouse)
RP169004	ABM	100 ug	Ask for price

RPL23A Recombinant Protein (Rat)
RP226640	ABM	100 ug	Ask for price

Human RPL23A shRNA Plasmid
20-abx954136	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

[One Step] RPL23A Antibody Kit
RK05699	Abclonal	50 ul	EUR 240

RPL23A Blocking Peptide
33R-9529	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL23A antibody, catalog no. 70R-10400

RPL23A Conjugated Antibody
C47280	SAB	100ul	EUR 397

RPL23A cloning plasmid
CSB-CL020187HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 471 Sequence: atggcgccgaaagcgaagaaggaagctcctgcccctcctaaagctgaagccaaagcgaaggctttaaaggccaagaaggcagtgttgaaaggtgtccacagccacaaaaagaagaagatccgcacgtcacccaccttccggcggccgaagacactgcgactccggagacagcccaa Show more
Description: A cloning plasmid for the RPL23A gene.

RPL23A Rabbit pAb
A4086-100ul	Abclonal	100 ul	EUR 308

RPL23A Rabbit pAb
A4086-200ul	Abclonal	200 ul	EUR 459

RPL23A Rabbit pAb
A4086-20ul	Abclonal	20 ul	EUR 183

RPL23A Rabbit pAb
A4086-50ul	Abclonal	50 ul	EUR 223

anti- RPL23A antibody
FNab07423	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein L23a Uniprot ID: P62750 Gene ID: 6147 Research Area: Metabolism
Description: Antibody raised against RPL23A

Anti-RPL23A antibody
PAab07423	Lifescience Market	100 ug	EUR 386

Anti-RPL23A antibody
STJ25395	St John's Laboratory	100 µl	EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins. It is located in the cytoplasm. The protein may be one of the target molecules involved in mediating growth inhibition by interferon. In yeast, the corresponding protein binds to a specific site on the 26S rRNA. This gene is co-transcribed with the U42A, U42B, U101A, and U101B small nucleolar RNA genes, which are located in its third, first, second, and fourth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL23A (3E11)
YF-MA15244	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RPL23A

Human Ribosomal Protein L10 ELISA kit
E01R0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L10 ELISA kit
E01R0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L10 ELISA kit
E01R0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L26 ELISA kit
E01R0075-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L26 ELISA kit
E01R0075-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L26 ELISA kit
E01R0075-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein S19 ELISA kit
E01R0076-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein S19 ELISA kit
E01R0076-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein S19 ELISA kit
E01R0076-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ribosomal protein L4 ELISA KIT|Human
EF002461	Lifescience Market	96 Tests	EUR 689

RPL23A ORF Vector (Human) (pORF)
ORF008970	ABM	1.0 ug DNA	EUR 95

RPL23A Protein Vector (Human) (pPB-C-His)
PV035877	ABM	500 ng	EUR 329

RPL23A Protein Vector (Human) (pPB-N-His)
PV035878	ABM	500 ng	EUR 329

RPL23A Protein Vector (Human) (pPM-C-HA)
PV035879	ABM	500 ng	EUR 329

RPL23A Protein Vector (Human) (pPM-C-His)
PV035880	ABM	500 ng	EUR 329

Recombinant Human RPL23A Protein, His, E.coli-10ug
QP13344-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human RPL23A Protein, His, E.coli-1mg
QP13344-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human RPL23A Protein, His, E.coli-2ug
QP13344-2ug	EnQuireBio	2ug	EUR 155

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
DLR-RPL13A-Hu-48T	DL Develop	48T	EUR 554
Should the Human Ribosomal Protein L13A (RPL13A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L13A (RPL13A) in samples from tissue homogenates or other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
DLR-RPL13A-Hu-96T	DL Develop	96T	EUR 725
Should the Human Ribosomal Protein L13A (RPL13A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L13A (RPL13A) in samples from tissue homogenates or other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit
DLR-RPL6-Hu-48T	DL Develop	48T	EUR 517
Should the Human Ribosomal Protein L6 (RPL6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L6 (RPL6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit
DLR-RPL6-Hu-96T	DL Develop	96T	EUR 673
Should the Human Ribosomal Protein L6 (RPL6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L6 (RPL6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Mitochondrial Ribosomal Protein L17 ELISA kit
E01M0227-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial Ribosomal Protein L17 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial Ribosomal Protein L17 ELISA kit
E01M0227-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial Ribosomal Protein L17 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial Ribosomal Protein L17 ELISA kit
E01M0227-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial Ribosomal Protein L17 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L6 (RPL6) ELISA Kit
20-abx152972	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
20-abx152982	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Ribosomal Protein S9 (RPS9) ELISA Kit
20-abx258583	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Ribosomal Protein L4 (RPL4) ELISA Kit
abx259815-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L13 (RPL13) ELISA Kit
abx251672-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human RPS19(Ribosomal protein S19) ELISA Kit
EH11973	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Ribosomal Protein L26 (RPL26) ELISA Kit
abx351725-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Ribosomal Protein L10 (RPL10) ELISA Kit
abx382895-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Ribosomal Protein L10A (RPL10A) ELISA Kit
abx382896-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L11 (RPL11) ELISA Kit
abx382897-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L12 (RPL12) ELISA Kit
abx382898-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L14 (RPL14) ELISA Kit
abx382900-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L15 (RPL15) ELISA Kit
abx382901-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L17 (RPL17) ELISA Kit
abx382902-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L18A (RPL18A) ELISA Kit
abx382903-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L19 (RPL19) ELISA Kit
abx382904-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L21 (RPL21) ELISA Kit
abx382905-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L22 (RPL22) ELISA Kit
abx382906-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L23 (RPL23) ELISA Kit
abx382907-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L24 (RPL24) ELISA Kit
abx382909-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L27 (RPL27) ELISA Kit
abx382911-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L27A (RPL27A) ELISA Kit
abx382912-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L28 (RPL28) ELISA Kit
abx382913-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L3 (RPL3) ELISA Kit
abx382914-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L30 (RPL30) ELISA Kit
abx382915-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L31 (RPL31) ELISA Kit
abx382916-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L32 (RPL32) ELISA Kit
abx382917-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L35 (RPL35) ELISA Kit
abx382918-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L37a (RPL37A) ELISA Kit
abx382920-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L38 (RPL38) ELISA Kit
abx382921-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L39 (RPL39) ELISA Kit
abx382922-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L5 (RPL5) ELISA Kit
abx382924-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L7 (RPL7) ELISA Kit
abx382926-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L7a (RPL7A) ELISA Kit
abx382927-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L8 (RPL8) ELISA Kit
abx382929-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein L9 (RPL9) ELISA Kit
abx382930-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S10 (RPS10) ELISA Kit
abx382940-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S12 (RPS12) ELISA Kit
abx382941-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S16 (RPS16) ELISA Kit
abx382944-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S19 (RPS19) ELISA Kit
20-abx382945	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Ribosomal Protein S20 (RPS20) ELISA Kit
abx382946-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S21 (RPS21) ELISA Kit
abx382947-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S24 (RPS24) ELISA Kit
abx382948-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S26 (RPS26) ELISA Kit
abx382950-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S27 (RPS27) ELISA Kit
abx382951-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S28 (RPS28) ELISA Kit
abx382953-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S29 (RPS29) ELISA Kit
abx382954-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S3 (RPS3) ELISA Kit
abx382955-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S3A (RPS3A) ELISA Kit
abx382956-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S5 (RPS5) ELISA Kit
abx382959-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S6 (RPS6) ELISA Kit
abx382960-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S7 (RPS7) ELISA Kit
abx382962-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S8 (RPS8) ELISA Kit
abx382963-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosomal Protein S13 (RPS13) ELISA Kit
20-abx585091	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Ribosomal Protein S25 (RPS25) ELISA Kit
20-abx585301	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Ribosomal Protein S15 (RPS15) ELISA Kit
abx520475-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Ribosomal Protein L6(RPL6)ELISA Kit
QY-E03156	Qayee Biotechnology	96T	EUR 361

Human Ribosomal Protein S9 (RPS9) ELISA Kit
SEF039Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit
SEF039Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit
SEF039Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit
SEF039Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit
4-SEF039Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Ribosomal Protein S9 elisa. Alternative names of the recognized antigen: 40S Ribosomal Protein S9
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribosomal Protein S9 (RPS9) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Ribosomal Protein L6 (RPL6) ELISA Kit
SEF046Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit
SEF046Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit
SEF046Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit
SEF046Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit
4-SEF046Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Ribosomal Protein L6 elisa. Alternative names of the recognized antigen: SHUJUN-2 TAXREB107 TXREB1 Neoplasm-related protein C140 Tax-responsive enhancer element-binding protein 107
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribosomal Protein L6 (RPL6) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
RDR-RPL13A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
RDR-RPL13A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Ribosomal Protein L6 (RPL6) ELISA Kit
RDR-RPL6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Ribosomal Protein L6 (RPL6) ELISA Kit
RDR-RPL6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
RD-RPL13A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
RD-RPL13A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Ribosomal Protein L6 (RPL6) ELISA Kit
RD-RPL6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Ribosomal Protein L6 (RPL6) ELISA Kit
RD-RPL6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
SEQ321Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
SEQ321Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
SEQ321Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
SEQ321Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit
4-SEQ321Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Ribosomal Protein L13A elisa. Alternative names of the recognized antigen: TSTA1 Tissue Specific Transplantation Antigen 1 60S ribosomal protein L13a 23 kDa highly basic protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribosomal Protein L13A (RPL13A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat RPL23A shRNA Plasmid
20-abx990060	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL23A Antibody, HRP conjugated
1-CSB-PA020187LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL23A. Recognizes RPL23A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL23A Antibody, FITC conjugated
1-CSB-PA020187LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL23A. Recognizes RPL23A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL23A Antibody, Biotin conjugated
1-CSB-PA020187LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL23A. Recognizes RPL23A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse RPL23A shRNA Plasmid
20-abx982954	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL23A sgRNA CRISPR Lentivector set (Human)
K1938401	ABM	3 x 1.0 ug	EUR 339

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Rabbit Ribosomal Protein L10 ELISA kit
E04R0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein L10 ELISA kit
E04R0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein L10 ELISA kit
E04R0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein L26 ELISA kit
E04R0075-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein L26 ELISA kit
E04R0075-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein L26 ELISA kit
E04R0075-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein S19 ELISA kit
E04R0076-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein S19 ELISA kit
E04R0076-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosomal Protein S19 ELISA kit
E04R0076-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L10 ELISA kit
E02R0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L10 ELISA kit
E02R0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L10 ELISA kit
E02R0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L26 ELISA kit
E02R0075-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L26 ELISA kit
E02R0075-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein L26 ELISA kit
E02R0075-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein S19 ELISA kit
E02R0076-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein S19 ELISA kit
E02R0076-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosomal Protein S19 ELISA kit
E02R0076-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L10 ELISA kit
E03R0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L10 ELISA kit
E03R0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L10 ELISA kit
E03R0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L26 ELISA kit
E03R0075-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L26 ELISA kit
E03R0075-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein L26 ELISA kit
E03R0075-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein S19 ELISA kit
E03R0076-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosomal Protein S19 ELISA kit
E03R0076-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RPL23A(Ribosomal Protein L23A) ELISA Kit