Human STOML2 ELISA kit

Human STOML2 ELISA kit

To Order Contact us: [email protected]

Human Stomatin Like 2 (STOML2) ELISA Kit

abx383537-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STOML2 antibody

70R-20609 50 ul
EUR 435
Description: Rabbit polyclonal STOML2 antibody

STOML2 Antibody

39917-100ul 100ul
EUR 390

STOML2 antibody

70R-10371 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal STOML2 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STOML2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STOML2 Antibody

DF12010 200ul
EUR 304
Description: STOML2 antibody detects endogenous levels of STOML2.

STOML2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


PVT19033 2 ug
EUR 231


YF-PA18713 50 ug
EUR 363
Description: Mouse polyclonal to STOML2


YF-PA18714 100 ul
EUR 403
Description: Rabbit polyclonal to STOML2


YF-PA18715 100 ug
EUR 403
Description: Rabbit polyclonal to STOML2

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human STOML2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STOML2 Recombinant Protein (Human)

RP030469 100 ug Ask for price

STOML2 Recombinant Protein (Human)

RP030472 100 ug Ask for price

Human Stomatin- like protein 2, STOML2 ELISA KIT

ELI-39539h 96 Tests
EUR 824

anti- STOML2 antibody

FNab08346 100µg
EUR 548.75
  • Immunogen: stomatin(EPB72)-like 2
  • Uniprot ID: Q9UJZ1
  • Gene ID: 30968
  • Research Area: cancer
Description: Antibody raised against STOML2

anti- STOML2 antibody

FNab08347 100µg
EUR 548.75
  • Recommended dilution: WB: 1:2000-1:10000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: stomatin(EPB72)-like 2
  • Uniprot ID: Q9UJZ1
  • Gene ID: 30968
  • Research Area: cancer
Description: Antibody raised against STOML2

STOML2 Rabbit pAb

A10398-100ul 100 ul
EUR 308

STOML2 Rabbit pAb

A10398-200ul 200 ul
EUR 459

STOML2 Rabbit pAb

A10398-20ul 20 ul
EUR 183

STOML2 Rabbit pAb

A10398-50ul 50 ul
EUR 223

STOML2 Rabbit pAb

A4688-100ul 100 ul
EUR 308

STOML2 Rabbit pAb

A4688-200ul 200 ul
EUR 459

STOML2 Rabbit pAb

A4688-20ul 20 ul Ask for price

STOML2 Rabbit pAb

A4688-50ul 50 ul Ask for price

STOML2 Blocking Peptide

33R-9858 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STOML2 antibody, catalog no. 70R-10371

STOML2 Polyclonal Antibody

27419-100ul 100ul
EUR 252

STOML2 Polyclonal Antibody

27419-50ul 50ul
EUR 187

STOML2 Blocking Peptide

DF12010-BP 1mg
EUR 195

STOML2 cloning plasmid

CSB-CL892131HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc
  • Show more
Description: A cloning plasmid for the STOML2 gene.

STOML2 cloning plasmid

CSB-CL892131HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc
  • Show more
Description: A cloning plasmid for the STOML2 gene.

Anti-STOML2 antibody

PAab08346 100 ug
EUR 386

pOTB7-stoml2 Plasmid

PVTB00105 2 ug
EUR 356

pOTB7-STOML2 Plasmid

PVTB00250S 2 ug
EUR 356

pENTR223-STOML2 vector

PVT12019 2 ug
EUR 308

Anti-STOML2 antibody

STJ25737 100 µl
EUR 277

Anti-STOML2 antibody

STJ112434 100 µl
EUR 277

STOML2 ORF Vector (Human) (pORF)

ORF010157 1.0 ug DNA
EUR 95

STOML2 ORF Vector (Human) (pORF)

ORF010158 1.0 ug DNA
EUR 95

Mouse Stomatin- like protein 2, Stoml2 ELISA KIT

ELI-53363m 96 Tests
EUR 865

Bovine Stomatin- like protein 2, STOML2 ELISA KIT

ELI-46244b 96 Tests
EUR 928

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Polyclonal STOML2 Antibody (Center)

APR04539G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STOML2 (Center). This antibody is tested and proven to work in the following applications:

STOML2 Polyclonal Conjugated Antibody

C27419 100ul
EUR 397

Mouse STOML2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat STOML2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STOML2 Recombinant Protein (Rat)

RP231512 100 ug Ask for price

STOML2 Recombinant Protein (Mouse)

RP176132 100 ug Ask for price


PVT18858 2 ug
EUR 231

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

STOML2 sgRNA CRISPR Lentivector set (Human)

K2305701 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Stomatin Like 2 (STOML2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx036120-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx031486-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx031486-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx238346-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stomatin Like 2 (STOML2) Antibody

abx238347-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stoml2 ORF Vector (Mouse) (pORF)

ORF058712 1.0 ug DNA
EUR 506

Stoml2 ORF Vector (Rat) (pORF)

ORF077172 1.0 ug DNA
EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

STOML2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2305702 1.0 ug DNA
EUR 154

STOML2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2305703 1.0 ug DNA
EUR 154

STOML2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2305704 1.0 ug DNA
EUR 154

STOML2 Protein Vector (Human) (pPB-C-His)

PV040625 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPB-N-His)

PV040626 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPM-C-HA)

PV040627 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPM-C-His)

PV040628 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPB-C-His)

PV040629 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPB-N-His)

PV040630 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPM-C-HA)

PV040631 500 ng
EUR 329

STOML2 Protein Vector (Human) (pPM-C-His)

PV040632 500 ng
EUR 329

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV715539 1.0 ug DNA
EUR 316

STOML2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV715543 1.0 ug DNA
EUR 316

STOML2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV715544 1.0 ug DNA
EUR 316

Stoml2 sgRNA CRISPR Lentivector set (Mouse)

K4605401 3 x 1.0 ug
EUR 339

Stoml2 sgRNA CRISPR Lentivector set (Rat)

K7189501 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4605402 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4605403 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4605404 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7189502 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7189503 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7189504 1.0 ug DNA
EUR 154

STOML2 Protein Vector (Rat) (pPB-C-His)

PV308686 500 ng
EUR 603

STOML2 Protein Vector (Rat) (pPB-N-His)

PV308687 500 ng
EUR 603

STOML2 Protein Vector (Rat) (pPM-C-HA)

PV308688 500 ng
EUR 603

STOML2 Protein Vector (Rat) (pPM-C-His)

PV308689 500 ng
EUR 603

STOML2 Protein Vector (Mouse) (pPB-C-His)

PV234846 500 ng
EUR 603

STOML2 Protein Vector (Mouse) (pPB-N-His)

PV234847 500 ng
EUR 603

STOML2 Protein Vector (Mouse) (pPM-C-HA)

PV234848 500 ng
EUR 603

STOML2 Protein Vector (Mouse) (pPM-C-His)

PV234849 500 ng
EUR 603

Stoml2 3'UTR GFP Stable Cell Line

TU169867 1.0 ml Ask for price

Stoml2 3'UTR Luciferase Stable Cell Line

TU119867 1.0 ml Ask for price

STOML2 3'UTR GFP Stable Cell Line

TU074839 1.0 ml
EUR 1394

STOML2 3'UTR Luciferase Stable Cell Line

TU024839 1.0 ml
EUR 1394

Stoml2 3'UTR Luciferase Stable Cell Line

TU221333 1.0 ml Ask for price

Stoml2 3'UTR GFP Stable Cell Line

TU271333 1.0 ml Ask for price

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2305705 3 x 1.0 ug
EUR 376

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV690319 1.0 ug DNA
EUR 682

STOML2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV690323 1.0 ug DNA
EUR 682

STOML2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV690324 1.0 ug DNA
EUR 682

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2305706 1.0 ug DNA
EUR 167

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2305707 1.0 ug DNA
EUR 167

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2305708 1.0 ug DNA
EUR 167

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV715540 1.0 ug DNA
EUR 316

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV715541 1.0 ug DNA
EUR 374

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV715542 1.0 ug DNA
EUR 374

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4605405 3 x 1.0 ug
EUR 376

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7189505 3 x 1.0 ug
EUR 376

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4605406 1.0 ug DNA
EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4605407 1.0 ug DNA
EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4605408 1.0 ug DNA
EUR 167

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV690320 1.0 ug DNA
EUR 682

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV690321 1.0 ug DNA
EUR 740

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV690322 1.0 ug DNA
EUR 740

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7189506 1.0 ug DNA
EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7189507 1.0 ug DNA
EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7189508 1.0 ug DNA
EUR 167


EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit

ELA-E0121h 96 Tests
EUR 824


LF-EK50791 1×96T
EUR 648

KIT ELISA Kit (Human) (OKAN04574)

OKAN04574 96 Wells
EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)

OKCD06003 96 Wells
EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Biopterin ELISA Kit

CELI-66011h 96 Tests
EUR 824

Human lipopolysaccharides ELISA Kit

CELI-66031h 96 Tests
EUR 824

Human Microlbumin ELISA Kit

abx517025-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Trypsin ELISA kit

E01T0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit

E01T0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human STOML2 ELISA kit