Human STOML2 ELISA kit

Human STOML2 ELISA kit

To Order Contact us: [email protected]

Human Stomatin Like 2 (STOML2) ELISA Kit
abx383537-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

STOML2 antibody
70R-10371	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal STOML2 antibody

STOML2 antibody
70R-20609	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal STOML2 antibody

STOML2 Antibody
39917-100ul	SAB	100ul	EUR 390

STOML2 Antibody
1-CSB-PA892131ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STOML2 Antibody
DF12010	Affbiotech	200ul	EUR 304
Description: STOML2 antibody detects endogenous levels of STOML2.

STOML2 Antibody
1-CSB-PA022864GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

STOML2 siRNA
20-abx905340	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STOML2 siRNA
20-abx935507	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STOML2 siRNA
20-abx935508	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-STOML2
PVT19033	Lifescience Market	2 ug	EUR 231

anti-STOML2
YF-PA18713	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to STOML2

anti-STOML2
YF-PA18714	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to STOML2

anti-STOML2
YF-PA18715	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to STOML2

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human STOML2 shRNA Plasmid
20-abx959362	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

STOML2 Recombinant Protein (Human)
RP030469	ABM	100 ug	Ask for price

STOML2 Recombinant Protein (Human)
RP030472	ABM	100 ug	Ask for price

Human Stomatin- like protein 2, STOML2 ELISA KIT
ELI-39539h	Lifescience Market	96 Tests	EUR 824

STOML2 Polyclonal Antibody
27419-100ul	SAB	100ul	EUR 252

STOML2 Polyclonal Antibody
27419-50ul	SAB	50ul	EUR 187

STOML2 Rabbit pAb
A10398-100ul	Abclonal	100 ul	EUR 308

STOML2 Rabbit pAb
A10398-200ul	Abclonal	200 ul	EUR 459

STOML2 Rabbit pAb
A10398-20ul	Abclonal	20 ul	EUR 183

STOML2 Rabbit pAb
A10398-50ul	Abclonal	50 ul	EUR 223

STOML2 Blocking Peptide
33R-9858	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STOML2 antibody, catalog no. 70R-10371

STOML2 cloning plasmid
CSB-CL892131HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1071 Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc Show more
Description: A cloning plasmid for the STOML2 gene.

STOML2 cloning plasmid
CSB-CL892131HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1071 Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc Show more
Description: A cloning plasmid for the STOML2 gene.

STOML2 Blocking Peptide
DF12010-BP	Affbiotech	1mg	EUR 195

STOML2 Rabbit pAb
A4688-100ul	Abclonal	100 ul	EUR 308

STOML2 Rabbit pAb
A4688-200ul	Abclonal	200 ul	EUR 459

STOML2 Rabbit pAb
A4688-20ul	Abclonal	20 ul	Ask for price

STOML2 Rabbit pAb
A4688-50ul	Abclonal	50 ul	Ask for price

anti- STOML2 antibody
FNab08346	FN Test	100µg	EUR 548.75
Immunogen: stomatin(EPB72)-like 2 Uniprot ID: Q9UJZ1 Gene ID: 30968 Research Area: cancer
Description: Antibody raised against STOML2

anti- STOML2 antibody
FNab08347	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:2000-1:10000 IP: 1:500-1:1000 IHC: 1:50-1:500 Immunogen: stomatin(EPB72)-like 2 Uniprot ID: Q9UJZ1 Gene ID: 30968 Research Area: cancer
Description: Antibody raised against STOML2

Anti-STOML2 antibody
PAab08346	Lifescience Market	100 ug	EUR 386

pENTR223-STOML2 vector
PVT12019	Lifescience Market	2 ug	EUR 308

pOTB7-stoml2 Plasmid
PVTB00105	Lifescience Market	2 ug	EUR 356

pOTB7-STOML2 Plasmid
PVTB00250S	Lifescience Market	2 ug	EUR 356

Anti-STOML2 antibody
STJ25737	St John's Laboratory	100 µl	EUR 277

Anti-STOML2 antibody
STJ112434	St John's Laboratory	100 µl	EUR 277

STOML2 ORF Vector (Human) (pORF)
ORF010157	ABM	1.0 ug DNA	EUR 95

STOML2 ORF Vector (Human) (pORF)
ORF010158	ABM	1.0 ug DNA	EUR 95

Mouse Stomatin- like protein 2, Stoml2 ELISA KIT
ELI-53363m	Lifescience Market	96 Tests	EUR 865

Bovine Stomatin- like protein 2, STOML2 ELISA KIT
ELI-46244b	Lifescience Market	96 Tests	EUR 928

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Polyclonal STOML2 Antibody (Center)
APR04539G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STOML2 (Center). This antibody is tested and proven to work in the following applications:

Rat STOML2 shRNA Plasmid
20-abx988911	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse STOML2 shRNA Plasmid
20-abx975687	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

STOML2 Polyclonal Conjugated Antibody
C27419	SAB	100ul	EUR 397

STOML2 Recombinant Protein (Rat)
RP231512	ABM	100 ug	Ask for price

pCMV-SPORT6-Stoml2-m
PVT18858	Lifescience Market	2 ug	EUR 231

STOML2 Recombinant Protein (Mouse)
RP176132	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

STOML2 sgRNA CRISPR Lentivector set (Human)
K2305701	ABM	3 x 1.0 ug	EUR 339

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Stomatin Like 2 (STOML2) Antibody
20-abx003539	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
20-abx126669	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx036120-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx031486-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx031486-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx238346-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Stomatin Like 2 (STOML2) Antibody
abx238347-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Stomatin Like 2 (STOML2) Antibody
20-abx321350	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Stoml2 ORF Vector (Rat) (pORF)
ORF077172	ABM	1.0 ug DNA	EUR 506

Stoml2 ORF Vector (Mouse) (pORF)
ORF058712	ABM	1.0 ug DNA	EUR 506

STOML2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2305702	ABM	1.0 ug DNA	EUR 154

STOML2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2305703	ABM	1.0 ug DNA	EUR 154

STOML2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2305704	ABM	1.0 ug DNA	EUR 154

STOML2 Protein Vector (Human) (pPB-C-His)
PV040625	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPB-N-His)
PV040626	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPM-C-HA)
PV040627	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPM-C-His)
PV040628	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPB-C-His)
PV040629	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPB-N-His)
PV040630	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPM-C-HA)
PV040631	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPM-C-His)
PV040632	ABM	500 ng	EUR 329

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715539	ABM	1.0 ug DNA	EUR 316

STOML2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV715543	ABM	1.0 ug DNA	EUR 316

Human STOML2 ELISA kit