Mouse AZU1(Azurocidin 1) ELISA Kit
To Order Contact us: [email protected]
Human Azurocidin 1 (AZU1) ELISA Kit |
RD-AZU1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Azurocidin 1 (AZU1) ELISA Kit |
RDR-AZU1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Azurocidin 1 (AZU1) ELISA Kit |
RDR-AZU1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Pig Azurocidin 1 (AZU1) ELISA Kit |
abx360694-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Azurocidin 1 (AZU1) ELISA Kit |
abx363610-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Azurocidin 1 (AZU1) ELISA Kit |
20-abx150776 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Sheep Azurocidin 1 (AZU1) ELISA Kit |
abx364524-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Monkey Azurocidin 1 (AZU1) ELISA Kit |
abx358902-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Azurocidin 1 (AZU1) ELISA Kit |
abx355659-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rat Azurocidin 1 (AZU1) ELISA Kit |
abx256722-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Azurocidin 1 (AZU1) ELISA Kit |
abx250179-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Azurocidin 1 (AZU1) ELISA Kit |
SEB461Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Azurocidin 1 (AZU1) ELISA Kit |
SEB461Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Azurocidin 1 (AZU1) ELISA Kit |
SEB461Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Azurocidin 1 (AZU1) ELISA Kit |
SEB461Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Azurocidin 1 (AZU1) ELISA Kit |
4-SEB461Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Azurocidin 1 elisa. Alternative names of the recognized antigen: AZAMP
- AZU
- HBP
- HUMAZUR
- NAZC
- CAP37
- Cationic Antimicrobial Protein 37
- Heparin-Binding Protein
- Neutrophil Azurocidin
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Azurocidin 1 (AZU1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Azurocidin 1 ELISA Kit (AZU1) |
RK00961 |
Abclonal |
96 Tests |
EUR 521 |
Azurocidin 1 (AZU1) Antibody |
20-abx100894 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Azurocidin 1 (AZU1) Antibody |
20-abx006318 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Azurocidin 1 (AZU1) Antibody |
abx028459-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Azurocidin 1 (AZU1) Antibody |
abx028459-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Azurocidin 1 (AZU1) Antibody |
20-abx320180 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Azurocidin 1 (AZU1) Antibody |
20-abx322246 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Azurocidin 1 (AZU1) Antibody |
20-abx171381 |
Abbexa |
-
EUR 328.00
-
EUR 815.00
-
EUR 425.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Recombinant Azurocidin 1 (AZU1) |
4-RPB461Hu01 |
Cloud-Clone |
-
EUR 447.65
-
EUR 223.00
-
EUR 1403.68
-
EUR 534.56
-
EUR 969.12
-
EUR 362.00
-
EUR 3359.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20160
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.6kDa
- Isoelectric Point: 9.1
|
Description: Recombinant Human Azurocidin 1 expressed in: E.coli |
Human AZU1/ Azurocidin ELISA Kit |
E0243Hu |
Sunlong |
1 Kit |
EUR 571 |
Human AZU1(Azurocidin) ELISA Kit |
EH0041 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P20160
- Alias: AZU1(Azurocidin 1)/AZAMP/AZU1/CAP37/HBP/AZAMP/AZU/azurocidin/azurocidin 1/Azurocidin/Cationic Antimicrobial Protein-37/Heparin Binding Protein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
ELISA kit for Human AZU1 (Azurocidin 1) |
ELK1990 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Azurocidin 1 (AZU1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Azurocidin 1 (
- Show more
|
Description: A sandwich ELISA kit for detection of Azurocidin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Guinea pig Azurocidin 1 (AZU1) ELISA Kit |
abx357837-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Human AZU1 (Azurocidin 1) |
E-EL-H0540 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's AZU1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human AZU1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human AZU1 (Azurocidin 1) in samples from Serum, Plasma, Cell supernatant |
Human Azurocidin 1 (AZU1) CLIA Kit |
abx196472-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Azurocidin 1 (AZU1) CLIA Kit |
20-abx492770 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Azurocidin 1 (AZU1) Protein |
20-abx065490 |
Abbexa |
-
EUR 634.00
-
EUR 272.00
-
EUR 1901.00
-
EUR 746.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Azurocidin 1 (AZU1) Antibody (Biotin) |
20-abx274274 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
CLIA kit for Human AZU1 (Azurocidin 1) |
E-CL-H0430 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's AZU1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human AZU1 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human AZU1 (Azurocidin 1) in samples from Serum, Plasma, Cell supernatant |
Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat) |
4-PAB461Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1) |
Recombinant Human AZU1/Azurocidin 1/CAP37 Protein |
RP00196 |
Abclonal |
10 μg |
EUR 155 |
Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), APC |
4-PAB461Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with APC. |
Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAB461Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with Biotin. |
Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAB461Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with Cy3. |
Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), FITC |
4-PAB461Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with FITC. |
Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), HRP |
4-PAB461Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with HRP. |
Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), PE |
4-PAB461Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with PE. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Azurocidin AssayMax ELISA Kit |
EA8121-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAB461Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with APC-Cy7. |
Mouse Azurocidin 1 ELISA kit |
E03A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Azurocidin 1 ELISA kit |
E03A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Azurocidin 1 ELISA kit |
E03A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse AZU1 ELISA Kit |
EMA0481 |
Abclonal |
96Tests |
EUR 521 |
Rabbit Azurocidin 1 ELISA kit |
E04A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Azurocidin 1 ELISA kit |
E04A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Azurocidin 1 ELISA kit |
E04A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Azurocidin 1 ELISA kit |
E06A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Azurocidin 1 ELISA kit |
E06A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Azurocidin 1 ELISA kit |
E06A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Azurocidin 1 ELISA kit |
E02A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Azurocidin 1 ELISA kit |
E02A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Azurocidin 1 ELISA kit |
E02A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Azurocidin 1 ELISA kit |
E01A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Azurocidin 1 ELISA kit |
E01A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Azurocidin 1 ELISA kit |
E01A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Azurocidin 1 ELISA kit |
E08A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Azurocidin 1 ELISA kit |
E08A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Azurocidin 1 ELISA kit |
E08A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Azurocidin 1 ELISA kit |
E07A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Azurocidin 1 ELISA kit |
E07A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Azurocidin 1 ELISA kit |
E07A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Azurocidin 1 ELISA kit |
E09A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Azurocidin 1 ELISA kit |
E09A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Azurocidin 1 ELISA kit |
E09A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Azurocidin 1 ELISA kit |
E05A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Azurocidin 1 ELISA kit |
E05A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Azurocidin 1 ELISA kit |
E05A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human AZU1 ELISA Kit |
EHA0481 |
Abclonal |
96Tests |
EUR 521 |
Goat AZU1 ELISA Kit |
EGTA0481 |
Abclonal |
96Tests |
EUR 521 |
Canine AZU1 ELISA Kit |
ECA0481 |
Abclonal |
96Tests |
EUR 521 |
Bovine AZU1 ELISA Kit |
EBA0481 |
Abclonal |
96Tests |
EUR 521 |
Anserini AZU1 ELISA Kit |
EAA0481 |
Abclonal |
96Tests |
EUR 521 |
Rat AZU1 ELISA Kit |
ERA0481 |
Abclonal |
96Tests |
EUR 521 |
Rabbit AZU1 ELISA Kit |
ERTA0481 |
Abclonal |
96Tests |
EUR 521 |
Porcine AZU1 ELISA Kit |
EPA0481 |
Abclonal |
96Tests |
EUR 521 |
Guinea Pig AZU1 ELISA Kit |
EGA0481 |
Abclonal |
96Tests |
EUR 521 |
AZU1 ELISA Kit (Human) (OKAN05407) |
OKAN05407 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.060 ng/mL |
AZU1 ELISA Kit (Human) (OKCD07410) |
OKCD07410 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL |
ELISA kit for Human Azurocidin |
EK3436 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Azurocidin in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human Azurocidin PicoKine ELISA Kit |
EK1161 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Azurocidin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Human azurocidin,AZU ELISA Kit |
201-12-0716 |
SunredBio |
96 tests |
EUR 440 |
- This azurocidin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human azurocidin,AZU ELISA Kit |
CN-04244H1 |
ChemNorm |
96T |
EUR 434 |
Human azurocidin,AZU ELISA Kit |
CN-04244H2 |
ChemNorm |
48T |
EUR 284 |
Azurocidin ELISA Kit (Human) (OKBB00518) |
OKBB00518 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Azurocidin, also known as cationic antimicrobial protein CAP37 or heparin-binding protein (HBP), is a protein that in humans is encoded by the AZU1 gene. This encoded protein is a member of the serine protease gene family, but it is not a serine proteinase, because the active site serine and histidine residues are replaced. Azurocidin is mapped to 19p13.3. The protein encoded by this gene is an azurophil granule antibiotic protein, with antibacterial activity. It is also an important multifunctional inflammatory mediator. In addition to it, Azurocidin is also a specific chemoattractant for monocytes. It lacks the chemotactic activity for neutrophils and lymphocytes, and this gene is probably responsible for the wave of monocytes that follows the initial wave of PMNs typical of the inflammatory response.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL |
AZU1 siRNA |
20-abx908749 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AZU1 Antibody |
1-CSB-PA002485ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
|
Description: A polyclonal antibody against AZU1. Recognizes AZU1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
AZU1 Antibody |
1-CSB-PA002485ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
|
Description: A polyclonal antibody against AZU1. Recognizes AZU1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
Azurocidin Protein |
abx069755-02mg |
Abbexa |
0.2 mg |
EUR 565 |
- Shipped within 5-10 working days.
|
anti-Azurocidin |
YF-PA10424 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Azurocidin |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
AZU1 ELISA Kit (Human) : 96 Wells (OKEH02655) |
OKEH02655 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.041 ng/mL |
AZU1 Rabbit pAb |
A6132-100ul |
Abclonal |
100 ul |
EUR 308 |
AZU1 Rabbit pAb |
A6132-200ul |
Abclonal |
200 ul |
EUR 459 |
AZU1 Rabbit pAb |
A6132-20ul |
Abclonal |
20 ul |
EUR 183 |
AZU1 Rabbit pAb |
A6132-50ul |
Abclonal |
50 ul |
EUR 223 |
AZU1 Rabbit pAb |
A13952-100ul |
Abclonal |
100 ul |
EUR 308 |
AZU1 Rabbit pAb |
A13952-200ul |
Abclonal |
200 ul |
EUR 459 |
AZU1 Rabbit pAb |
A13952-20ul |
Abclonal |
20 ul |
EUR 183 |
AZU1 Rabbit pAb |
A13952-50ul |
Abclonal |
50 ul |
EUR 223 |
AZU1 Polyclonal Antibody |
42077-100ul |
SAB |
100ul |
EUR 333 |
AZU1 cloning plasmid |
CSB-CL002485HU-10ug |
Cusabio |
10ug |
EUR 321 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 756
- Sequence: atgacccggctgacagtcctggccctgctggctggtctgctggcgtcctcgagggccggctccagcccccttttggacatcgttggcggccggaaggcgaggccccgccagttcccgttcctggcctccattcagaatcaaggcaggcacttctgcgggggtgccctgatccatgc
- Show more
|
Description: A cloning plasmid for the AZU1 gene. |
Anti-AZU1 antibody |
STJ27885 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. |
Anti-AZU1 antibody |
STJ115887 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. |
Human Azurocidin Antibody |
12100-05011 |
AssayPro |
150 ug |
EUR 217 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Human Azurocidin AssayMax ELISA Kit (Positive Control included) |
EA8121-7 |
AssayPro |
96 Well Plate |
EUR 536 |
ELISA kit for Rat AZU/HBP (Azurocidin/HeparinBindingProtein) Kit |
E-EL-R2538 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's AZU/HBP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat AZU/HBP. Standards or samples are added to the micro ELISA plate wells and combined wit
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat AZU/HBP (Azurocidin/HeparinBindingProtein) Kit in samples from Serum, Plasma, Cell supernatant |
AZU1 Polyclonal Conjugated Antibody |
C42077 |
SAB |
100ul |
EUR 397 |
Human AZU1 shRNA Plasmid |
20-abx950386 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
AZU1 Recombinant Protein (Human) |
RP002503 |
ABM |
100 ug |
Ask for price |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
AZU1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0162302 |
ABM |
1.0 ug DNA |
EUR 154 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
AZU/HBP ELISA Kit| Rat Azurocidin/Heparin Binding Protein ELISA |
EF016962 |
Lifescience Market |
96 Tests |
EUR 689 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Human Azurocidin/Heparin Binding Protein(AZU/HBP) ELISA Kit |
CSB-E09698h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Azurocidin/Heparin Binding Protein (AZU/HBP) in samples from serum, urine, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse AZU1(Azurocidin 1) ELISA Kit