Mouse AZU1(Azurocidin 1) ELISA Kit
To Order Contact us: [email protected]
 ELISA Kit) Human Azurocidin 1 (AZU1) ELISA Kit |
|
RD-AZU1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Azurocidin 1 (AZU1) ELISA Kit |
|
RDR-AZU1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Azurocidin 1 (AZU1) ELISA Kit |
|
RDR-AZU1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
 ELISA Kit) Pig Azurocidin 1 (AZU1) ELISA Kit |
|
abx360694-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rabbit Azurocidin 1 (AZU1) ELISA Kit |
|
abx363610-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Azurocidin 1 (AZU1) ELISA Kit |
|
20-abx150776 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Sheep Azurocidin 1 (AZU1) ELISA Kit |
|
abx364524-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Monkey Azurocidin 1 (AZU1) ELISA Kit |
|
abx358902-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Chicken Azurocidin 1 (AZU1) ELISA Kit |
|
abx355659-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Azurocidin 1 (AZU1) ELISA Kit |
|
abx256722-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Azurocidin 1 (AZU1) ELISA Kit |
|
abx250179-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Azurocidin 1 (AZU1) ELISA Kit |
|
SEB461Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Azurocidin 1 (AZU1) ELISA Kit |
|
SEB461Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Azurocidin 1 (AZU1) ELISA Kit |
|
SEB461Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Azurocidin 1 (AZU1) ELISA Kit |
|
SEB461Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Azurocidin 1 (AZU1) ELISA Kit |
|
4-SEB461Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Azurocidin 1 elisa. Alternative names of the recognized antigen: AZAMP
- AZU
- HBP
- HUMAZUR
- NAZC
- CAP37
- Cationic Antimicrobial Protein 37
- Heparin-Binding Protein
- Neutrophil Azurocidin
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Azurocidin 1 (AZU1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
) Human Azurocidin 1 ELISA Kit (AZU1) |
|
RK00961 |
Abclonal |
96 Tests |
EUR 521 |
 Antibody) Azurocidin 1 (AZU1) Antibody |
|
20-abx100894 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Azurocidin 1 (AZU1) Antibody |
|
20-abx006318 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Azurocidin 1 (AZU1) Antibody |
|
abx028459-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Azurocidin 1 (AZU1) Antibody |
|
abx028459-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Azurocidin 1 (AZU1) Antibody |
|
20-abx320180 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Azurocidin 1 (AZU1) Antibody |
|
20-abx322246 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Azurocidin 1 (AZU1) Antibody |
|
20-abx171381 |
Abbexa |
-
EUR 328.00
-
EUR 815.00
-
EUR 425.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
) Recombinant Azurocidin 1 (AZU1) |
|
4-RPB461Hu01 |
Cloud-Clone |
-
EUR 447.65
-
EUR 223.00
-
EUR 1403.68
-
EUR 534.56
-
EUR 969.12
-
EUR 362.00
-
EUR 3359.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20160
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.6kDa
- Isoelectric Point: 9.1
|
|
Description: Recombinant Human Azurocidin 1 expressed in: E.coli |
 Human AZU1/ Azurocidin ELISA Kit |
|
E0243Hu |
Sunlong |
1 Kit |
EUR 571 |
 ELISA Kit) Human AZU1(Azurocidin) ELISA Kit |
|
EH0041 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P20160
- Alias: AZU1(Azurocidin 1)/AZAMP/AZU1/CAP37/HBP/AZAMP/AZU/azurocidin/azurocidin 1/Azurocidin/Cationic Antimicrobial Protein-37/Heparin Binding Protein
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
) ELISA kit for Human AZU1 (Azurocidin 1) |
|
ELK1990 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Azurocidin 1 (AZU1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Azurocidin 1 (
- Show more
|
|
Description: A sandwich ELISA kit for detection of Azurocidin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 ELISA Kit) Guinea pig Azurocidin 1 (AZU1) ELISA Kit |
|
abx357837-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Human AZU1 (Azurocidin 1) |
|
E-EL-H0540 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's AZU1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human AZU1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human AZU1 (Azurocidin 1) in samples from Serum, Plasma, Cell supernatant |
 CLIA Kit) Human Azurocidin 1 (AZU1) CLIA Kit |
|
abx196472-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Azurocidin 1 (AZU1) CLIA Kit |
|
20-abx492770 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 Protein) Human Azurocidin 1 (AZU1) Protein |
|
20-abx065490 |
Abbexa |
-
EUR 634.00
-
EUR 272.00
-
EUR 1901.00
-
EUR 746.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Antibody (Biotin)) Azurocidin 1 (AZU1) Antibody (Biotin) |
|
20-abx274274 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
) CLIA kit for Human AZU1 (Azurocidin 1) |
|
E-CL-H0430 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's AZU1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human AZU1 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
|
Description: A sandwich CLIA kit for quantitative measurement of Human AZU1 (Azurocidin 1) in samples from Serum, Plasma, Cell supernatant |
 Polyclonal Antibody (Human, Rat)) Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat) |
|
4-PAB461Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1) |
 Recombinant Human AZU1/Azurocidin 1/CAP37 Protein |
|
RP00196 |
Abclonal |
10 μg |
EUR 155 |
 Polyclonal Antibody (Human, Rat), APC) Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), APC |
|
4-PAB461Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with APC. |
 Polyclonal Antibody (Human, Rat), Biotinylated) Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), Biotinylated |
|
4-PAB461Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human, Rat), Cy3) Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), Cy3 |
|
4-PAB461Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human, Rat), FITC) Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), FITC |
|
4-PAB461Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human, Rat), HRP) Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), HRP |
|
4-PAB461Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human, Rat), PE) Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), PE |
|
4-PAB461Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with PE. |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 Human Azurocidin AssayMax ELISA Kit |
|
EA8121-1 |
AssayPro |
96 Well Plate |
EUR 477 |
 Polyclonal Antibody (Human, Rat), APC-Cy7) Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), APC-Cy7 |
|
4-PAB461Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AZU1 (Pro23~Gly247)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with APC-Cy7. |
 Mouse Azurocidin 1 ELISA kit |
|
E03A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Azurocidin 1 ELISA kit |
|
E03A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Azurocidin 1 ELISA kit |
|
E03A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Mouse AZU1 ELISA Kit |
|
EMA0481 |
Abclonal |
96Tests |
EUR 521 |
 Rabbit Azurocidin 1 ELISA kit |
|
E04A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Azurocidin 1 ELISA kit |
|
E04A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Azurocidin 1 ELISA kit |
|
E04A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Goat Azurocidin 1 ELISA kit |
|
E06A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Azurocidin 1 ELISA kit |
|
E06A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Azurocidin 1 ELISA kit |
|
E06A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Rat Azurocidin 1 ELISA kit |
|
E02A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Azurocidin 1 ELISA kit |
|
E02A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Azurocidin 1 ELISA kit |
|
E02A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human Azurocidin 1 ELISA kit |
|
E01A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Azurocidin 1 ELISA kit |
|
E01A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Azurocidin 1 ELISA kit |
|
E01A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Dog Azurocidin 1 ELISA kit |
|
E08A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Azurocidin 1 ELISA kit |
|
E08A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Azurocidin 1 ELISA kit |
|
E08A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Pig Azurocidin 1 ELISA kit |
|
E07A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Azurocidin 1 ELISA kit |
|
E07A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Azurocidin 1 ELISA kit |
|
E07A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Monkey Azurocidin 1 ELISA kit |
|
E09A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Azurocidin 1 ELISA kit |
|
E09A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Azurocidin 1 ELISA kit |
|
E09A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human AZU1 ELISA Kit |
|
EHA0481 |
Abclonal |
96Tests |
EUR 521 |
 Goat AZU1 ELISA Kit |
|
EGTA0481 |
Abclonal |
96Tests |
EUR 521 |
 Canine AZU1 ELISA Kit |
|
ECA0481 |
Abclonal |
96Tests |
EUR 521 |
 Bovine AZU1 ELISA Kit |
|
EBA0481 |
Abclonal |
96Tests |
EUR 521 |
 Anserini AZU1 ELISA Kit |
|
EAA0481 |
Abclonal |
96Tests |
EUR 521 |
 Rat AZU1 ELISA Kit |
|
ERA0481 |
Abclonal |
96Tests |
EUR 521 |
 Rabbit AZU1 ELISA Kit |
|
ERTA0481 |
Abclonal |
96Tests |
EUR 521 |
 Porcine AZU1 ELISA Kit |
|
EPA0481 |
Abclonal |
96Tests |
EUR 521 |
 Guinea pig Azurocidin 1 ELISA kit |
|
E05A0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Azurocidin 1 ELISA kit |
|
E05A0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Azurocidin 1 ELISA kit |
|
E05A0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Guinea Pig AZU1 ELISA Kit |
|
EGA0481 |
Abclonal |
96Tests |
EUR 521 |
 ELISA kit for Human Azurocidin |
|
EK3436 |
SAB |
96 tests |
EUR 553 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Azurocidin in samples from serum, plasma, tissue homogenates and other biological fluids. |
 Human Azurocidin PicoKine ELISA Kit |
|
EK1161 |
BosterBio |
96 wells |
EUR 425 |
|
Description: For quantitative detection of human Azurocidin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
 Human azurocidin,AZU ELISA Kit |
|
201-12-0716 |
SunredBio |
96 tests |
EUR 440 |
- This azurocidin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human azurocidin,AZU ELISA Kit |
|
CN-04244H1 |
ChemNorm |
96T |
EUR 434 |
Human azurocidin,AZU ELISA Kit |
|
CN-04244H2 |
ChemNorm |
48T |
EUR 284 |
 AZU1 siRNA |
|
20-abx908749 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 AZU1 Antibody |
|
1-CSB-PA002485ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
|
|
Description: A polyclonal antibody against AZU1. Recognizes AZU1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
AZU1 Antibody |
|
1-CSB-PA002485ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
|
|
Description: A polyclonal antibody against AZU1. Recognizes AZU1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
 Azurocidin Protein |
|
abx069755-02mg |
Abbexa |
0.2 mg |
EUR 565 |
- Shipped within 5-10 working days.
|
 anti-Azurocidin |
|
YF-PA10424 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to Azurocidin |
) mRNAExpress mRNA Synthesis kit (5 reactions) |
|
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
) PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
) PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
 AZU1 Rabbit pAb |
|
A6132-100ul |
Abclonal |
100 ul |
EUR 308 |
AZU1 Rabbit pAb |
|
A6132-200ul |
Abclonal |
200 ul |
EUR 459 |
AZU1 Rabbit pAb |
|
A6132-20ul |
Abclonal |
20 ul |
EUR 183 |
AZU1 Rabbit pAb |
|
A6132-50ul |
Abclonal |
50 ul |
EUR 223 |
AZU1 Rabbit pAb |
|
A13952-100ul |
Abclonal |
100 ul |
EUR 308 |
AZU1 Rabbit pAb |
|
A13952-200ul |
Abclonal |
200 ul |
EUR 459 |
AZU1 Rabbit pAb |
|
A13952-20ul |
Abclonal |
20 ul |
EUR 183 |
AZU1 Rabbit pAb |
|
A13952-50ul |
Abclonal |
50 ul |
EUR 223 |
 AZU1 Polyclonal Antibody |
|
42077-100ul |
SAB |
100ul |
EUR 333 |
 AZU1 cloning plasmid |
|
CSB-CL002485HU-10ug |
Cusabio |
10ug |
EUR 321 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 756
- Sequence: atgacccggctgacagtcctggccctgctggctggtctgctggcgtcctcgagggccggctccagcccccttttggacatcgttggcggccggaaggcgaggccccgccagttcccgttcctggcctccattcagaatcaaggcaggcacttctgcgggggtgccctgatccatgc
- Show more
|
|
Description: A cloning plasmid for the AZU1 gene. |
 Anti-AZU1 antibody |
|
STJ27885 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. |
Anti-AZU1 antibody |
|
STJ115887 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. |
 Human Azurocidin Antibody |
|
12100-05011 |
AssayPro |
150 ug |
EUR 217 |
 with goat anti-rabbit HRP secondary antibody) ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
|
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
|
) PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) Human Azurocidin AssayMax ELISA Kit (Positive Control included) |
|
EA8121-7 |
AssayPro |
96 Well Plate |
EUR 536 |
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
 Kit) ELISA kit for Rat AZU/HBP (Azurocidin/HeparinBindingProtein) Kit |
|
E-EL-R2538 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's AZU/HBP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat AZU/HBP. Standards or samples are added to the micro ELISA plate wells and combined wit
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Rat AZU/HBP (Azurocidin/HeparinBindingProtein) Kit in samples from Serum, Plasma, Cell supernatant |
 AZU1 Polyclonal Conjugated Antibody |
|
C42077 |
SAB |
100ul |
EUR 397 |
 Human AZU1 shRNA Plasmid |
|
20-abx950386 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) AZU1 Recombinant Protein (Human) |
|
RP002503 |
ABM |
100 ug |
Ask for price |
 AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
|
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
|
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 (Target 1)) AZU1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0162302 |
ABM |
1.0 ug DNA |
EUR 154 |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 AZU/HBP ELISA Kit| Rat Azurocidin/Heparin Binding Protein ELISA |
|
EF016962 |
Lifescience Market |
96 Tests |
EUR 689 |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 ELISA Kit) Human Azurocidin/Heparin Binding Protein(AZU/HBP) ELISA Kit |
|
CSB-E09698h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Azurocidin/Heparin Binding Protein (AZU/HBP) in samples from serum, urine, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Azurocidin/Heparin Binding Protein(AZU/HBP) ELISA Kit |
|
1-CSB-E09698h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Azurocidin/Heparin Binding Protein(AZU/HBP) in samples from serum, urine, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 AssayMax ELISA Kit) Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit |
|
EMI2200-1 |
AssayPro |
96 Well Plate |
EUR 477 |
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
Mouse AZU1(Azurocidin 1) ELISA Kit
ELISA Kit)
