Mouse AZU1(Azurocidin 1) ELISA Kit

Mouse AZU1(Azurocidin 1) ELISA Kit

To Order Contact us: [email protected]

Human Azurocidin 1 (AZU1) ELISA Kit
RD-AZU1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Azurocidin 1 (AZU1) ELISA Kit
RDR-AZU1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Azurocidin 1 (AZU1) ELISA Kit
RDR-AZU1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Pig Azurocidin 1 (AZU1) ELISA Kit
abx360694-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Azurocidin 1 (AZU1) ELISA Kit
abx363610-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Azurocidin 1 (AZU1) ELISA Kit
20-abx150776	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Sheep Azurocidin 1 (AZU1) ELISA Kit
abx364524-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Monkey Azurocidin 1 (AZU1) ELISA Kit
abx358902-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Azurocidin 1 (AZU1) ELISA Kit
abx355659-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Azurocidin 1 (AZU1) ELISA Kit
abx256722-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Azurocidin 1 (AZU1) ELISA Kit
abx250179-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Azurocidin 1 (AZU1) ELISA Kit
SEB461Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Azurocidin 1 (AZU1) ELISA Kit
SEB461Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Azurocidin 1 (AZU1) ELISA Kit
SEB461Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Azurocidin 1 (AZU1) ELISA Kit
SEB461Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Azurocidin 1 (AZU1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Azurocidin 1 (AZU1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Azurocidin 1 (AZU1) ELISA Kit
4-SEB461Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Azurocidin 1 elisa. Alternative names of the recognized antigen: AZAMP AZU HBP HUMAZUR NAZC CAP37 Cationic Antimicrobial Protein 37 Heparin-Binding Protein Neutrophil Azurocidin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Azurocidin 1 (AZU1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Azurocidin 1 ELISA Kit (AZU1)
RK00961	Abclonal	96 Tests	EUR 521

Azurocidin 1 (AZU1) Antibody
20-abx100894	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Azurocidin 1 (AZU1) Antibody
20-abx006318	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Azurocidin 1 (AZU1) Antibody
abx028459-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Azurocidin 1 (AZU1) Antibody
abx028459-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Azurocidin 1 (AZU1) Antibody
20-abx320180	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Azurocidin 1 (AZU1) Antibody
20-abx322246	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Azurocidin 1 (AZU1) Antibody
20-abx171381	Abbexa	EUR 328.00 EUR 815.00 EUR 425.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-12 working days.

Recombinant Azurocidin 1 (AZU1)
4-RPB461Hu01	Cloud-Clone	EUR 447.65 EUR 223.00 EUR 1403.68 EUR 534.56 EUR 969.12 EUR 362.00 EUR 3359.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20160 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.6kDa Isoelectric Point: 9.1
Description: Recombinant Human Azurocidin 1 expressed in: E.coli

Human AZU1/ Azurocidin ELISA Kit
E0243Hu	Sunlong	1 Kit	EUR 571

Human AZU1(Azurocidin) ELISA Kit
EH0041	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P20160 Alias: AZU1(Azurocidin 1)/AZAMP/AZU1/CAP37/HBP/AZAMP/AZU/azurocidin/azurocidin 1/Azurocidin/Cationic Antimicrobial Protein-37/Heparin Binding Protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Azurocidin, AZU1 ELISA KIT
ELI-04783h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human AZU1 (Azurocidin 1)
ELK1990	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Azurocidin 1 (AZU1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Azurocidin 1 ( Show more
Description: A sandwich ELISA kit for detection of Azurocidin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Azurocidin 1 (AZU1) ELISA Kit
abx357837-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Human AZU1 (Azurocidin 1)
E-EL-H0540	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's AZU1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human AZU1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human AZU1 (Azurocidin 1) in samples from Serum, Plasma, Cell supernatant

Human Azurocidin 1 (AZU1) CLIA Kit
abx196472-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Azurocidin 1 (AZU1) CLIA Kit
20-abx492770	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Azurocidin 1 (AZU1) Protein
20-abx065490	Abbexa	EUR 634.00 EUR 272.00 EUR 1901.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Azurocidin 1 (AZU1) Antibody (Biotin)
20-abx274274	Abbexa	EUR 467.00 EUR 244.00 EUR 1358.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

CLIA kit for Human AZU1 (Azurocidin 1)
E-CL-H0430	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's AZU1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human AZU1 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human AZU1 (Azurocidin 1) in samples from Serum, Plasma, Cell supernatant

Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat)
4-PAB461Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AZU1 (Pro23~Gly247) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1)

Recombinant Human AZU1/Azurocidin 1/CAP37 Protein
RP00196	Abclonal	10 μg	EUR 155

Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), APC
4-PAB461Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AZU1 (Pro23~Gly247) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with APC.

Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAB461Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AZU1 (Pro23~Gly247) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with Biotin.

Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), Cy3
4-PAB461Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AZU1 (Pro23~Gly247) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with Cy3.

Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), FITC
4-PAB461Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AZU1 (Pro23~Gly247) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with FITC.

Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), HRP
4-PAB461Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AZU1 (Pro23~Gly247) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with HRP.

Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), PE
4-PAB461Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AZU1 (Pro23~Gly247) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with PE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Azurocidin AssayMax ELISA Kit
EA8121-1	AssayPro	96 Well Plate	EUR 477

Azurocidin 1 (AZU1) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAB461Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AZU1 (Pro23~Gly247) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Azurocidin 1 (AZU1). This antibody is labeled with APC-Cy7.

Mouse Azurocidin 1 ELISA kit
E03A0474-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Azurocidin 1 ELISA kit
E03A0474-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Azurocidin 1 ELISA kit
E03A0474-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse AZU1 ELISA Kit
EMA0481	Abclonal	96Tests	EUR 521

Rabbit Azurocidin 1 ELISA kit
E04A0474-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Azurocidin 1 ELISA kit
E04A0474-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Azurocidin 1 ELISA kit
E04A0474-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Azurocidin 1 ELISA kit
E06A0474-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Azurocidin 1 ELISA kit
E06A0474-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Azurocidin 1 ELISA kit
E06A0474-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Azurocidin 1 ELISA kit
E02A0474-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Azurocidin 1 ELISA kit
E02A0474-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Azurocidin 1 ELISA kit
E02A0474-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Azurocidin 1 ELISA kit
E01A0474-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Azurocidin 1 ELISA kit
E01A0474-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Azurocidin 1 ELISA kit
E01A0474-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Azurocidin 1 ELISA kit
E08A0474-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Azurocidin 1 ELISA kit
E08A0474-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Azurocidin 1 ELISA kit
E08A0474-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Azurocidin 1 ELISA kit
E07A0474-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Azurocidin 1 ELISA kit
E07A0474-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Azurocidin 1 ELISA kit
E07A0474-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Azurocidin 1 ELISA kit
E09A0474-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Azurocidin 1 ELISA kit
E09A0474-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Azurocidin 1 ELISA kit
E09A0474-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Azurocidin 1 ELISA kit
E05A0474-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Azurocidin 1 ELISA kit
E05A0474-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Azurocidin 1 ELISA kit
E05A0474-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Azurocidin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AZU1 ELISA Kit
EHA0481	Abclonal	96Tests	EUR 521

Human AZU1 ELISA Kit
ELA-E1461h	Lifescience Market	96 Tests	EUR 824

Goat AZU1 ELISA Kit
EGTA0481	Abclonal	96Tests	EUR 521

Canine AZU1 ELISA Kit
ECA0481	Abclonal	96Tests	EUR 521

Bovine AZU1 ELISA Kit
EBA0481	Abclonal	96Tests	EUR 521

Anserini AZU1 ELISA Kit
EAA0481	Abclonal	96Tests	EUR 521

AZU1 ELISA KIT|Human
EF005761	Lifescience Market	96 Tests	EUR 689

Rat AZU1 ELISA Kit
ERA0481	Abclonal	96Tests	EUR 521

Rabbit AZU1 ELISA Kit
ERTA0481	Abclonal	96Tests	EUR 521

Porcine AZU1 ELISA Kit
EPA0481	Abclonal	96Tests	EUR 521

Guinea Pig AZU1 ELISA Kit
EGA0481	Abclonal	96Tests	EUR 521

AZU1 ELISA Kit (Human) (OKAN05407)
OKAN05407	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.060 ng/mL

AZU1 ELISA Kit (Human) (OKCD07410)
OKCD07410	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

ELISA kit for Human Azurocidin
EK3436	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Azurocidin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Azurocidin PicoKine ELISA Kit
EK1161	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Azurocidin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human azurocidin(AZU)ELISA Kit
GA-E0732HM-48T	GenAsia Biotech	48T	EUR 289

Human azurocidin(AZU)ELISA Kit
GA-E0732HM-96T	GenAsia Biotech	96T	EUR 466

Human azurocidin,AZU ELISA Kit
201-12-0716	SunredBio	96 tests	EUR 440
This azurocidin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human azurocidin,AZU ELISA Kit
CN-04244H1	ChemNorm	96T	EUR 434

Human azurocidin,AZU ELISA Kit
CN-04244H2	ChemNorm	48T	EUR 284

Human azurocidin(AZU)ELISA Kit
QY-E01242	Qayee Biotechnology	96T	EUR 361

Azurocidin ELISA Kit (Human) (OKBB00518)
OKBB00518	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Azurocidin, also known as cationic antimicrobial protein CAP37 or heparin-binding protein (HBP), is a protein that in humans is encoded by the AZU1 gene. This encoded protein is a member of the serine protease gene family, but it is not a serine proteinase, because the active site serine and histidine residues are replaced. Azurocidin is mapped to 19p13.3. The protein encoded by this gene is an azurophil granule antibiotic protein, with antibacterial activity. It is also an important multifunctional inflammatory mediator. In addition to it, Azurocidin is also a specific chemoattractant for monocytes. It lacks the chemotactic activity for neutrophils and lymphocytes, and this gene is probably responsible for the wave of monocytes that follows the initial wave of PMNs typical of the inflammatory response.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

AZU1 siRNA
20-abx908749	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AZU1 Antibody
1-CSB-PA002485ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against AZU1. Recognizes AZU1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

AZU1 Antibody
1-CSB-PA002485ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against AZU1. Recognizes AZU1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Azurocidin Protein
abx069755-02mg	Abbexa	0.2 mg	EUR 565
Shipped within 5-10 working days.

anti-Azurocidin
YF-PA10424	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Azurocidin

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

AZU1 ELISA Kit (Human) : 96 Wells (OKEH02655)
OKEH02655	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.041 ng/mL

AZU1 Rabbit pAb
A6132-100ul	Abclonal	100 ul	EUR 308

AZU1 Rabbit pAb
A6132-200ul	Abclonal	200 ul	EUR 459

AZU1 Rabbit pAb
A6132-20ul	Abclonal	20 ul	EUR 183

AZU1 Rabbit pAb
A6132-50ul	Abclonal	50 ul	EUR 223

AZU1 Rabbit pAb
A13952-100ul	Abclonal	100 ul	EUR 308

AZU1 Rabbit pAb
A13952-200ul	Abclonal	200 ul	EUR 459

AZU1 Rabbit pAb
A13952-20ul	Abclonal	20 ul	EUR 183

AZU1 Rabbit pAb
A13952-50ul	Abclonal	50 ul	EUR 223

AZU1 Polyclonal Antibody
42077-100ul	SAB	100ul	EUR 333

AZU1 cloning plasmid
CSB-CL002485HU-10ug	Cusabio	10ug	EUR 321
Formulation: 10 μg plasmid + 200μl Glycerol Length: 756 Sequence: atgacccggctgacagtcctggccctgctggctggtctgctggcgtcctcgagggccggctccagcccccttttggacatcgttggcggccggaaggcgaggccccgccagttcccgttcctggcctccattcagaatcaaggcaggcacttctgcgggggtgccctgatccatgc Show more
Description: A cloning plasmid for the AZU1 gene.

pCR4-TOPO-AZU1
PVT19089	Lifescience Market	2 ug	EUR 231

Anti-AZU1 antibody
STJ27885	St John's Laboratory	100 µl	EUR 277
Description: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation.

Anti-AZU1 antibody
STJ115887	St John's Laboratory	100 µl	EUR 277
Description: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation.

Human Azurocidin Antibody
12100-05011	AssayPro	150 ug	EUR 217

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Human Azurocidin AssayMax ELISA Kit (Positive Control included)
EA8121-7	AssayPro	96 Well Plate	EUR 536

ELISA kit for Rat AZU/HBP (Azurocidin/HeparinBindingProtein) Kit
E-EL-R2538	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's AZU/HBP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat AZU/HBP. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat AZU/HBP (Azurocidin/HeparinBindingProtein) Kit in samples from Serum, Plasma, Cell supernatant

AZU1 Polyclonal Conjugated Antibody
C42077	SAB	100ul	EUR 397

Human AZU1 shRNA Plasmid
20-abx950386	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

AZU1 Recombinant Protein (Human)
RP002503	ABM	100 ug	Ask for price

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

AZU1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0162302	ABM	1.0 ug DNA	EUR 154

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

AZU/HBP ELISA Kit| Rat Azurocidin/Heparin Binding Protein ELISA
EF016962	Lifescience Market	96 Tests	EUR 689

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human Azurocidin/Heparin Binding Protein(AZU/HBP) ELISA Kit
CSB-E09698h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Azurocidin/Heparin Binding Protein (AZU/HBP) in samples from serum, urine, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse AZU1(Azurocidin 1) ELISA Kit