Mouse EGLN1(Egl Nine Homolog 1) ELISA Kit

Mouse EGLN1(Egl Nine Homolog 1) ELISA Kit

To Order Contact us: [email protected]

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
RD-EGLN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

Mouse Egl nine homolog 1, Egln1 ELISA KIT
ELI-32638m	Lifescience Market	96 Tests	EUR 865

Mouse Egl Nine Homolog 1(EGLN1)ELISA Kit
QY-E20507	Qayee Biotechnology	96T	EUR 361

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5333.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 526.89
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 709.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2894.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
4-SEL644Mu	Cloud-Clone	EUR 5384.00 EUR 2845.00 EUR 710.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3 HIFPH2 PHD2 C1orf12 SM20 ZMYND6 HIF Prolyl Hydroxylase 2 Prolyl hydroxylase domain-containing protein 2 Hypoxia-inducible factor prolyl hydroxylase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx176226	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx176227	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx176228	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx213651	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx112250	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx137353	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx141591	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx172198	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody
abx030444-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
abx030444-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx241216	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx320187	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx320188	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx322731	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx321661	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx001065	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Mouse Egl Nine Homolog 1 (EGLN1) Protein
20-abx653237	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Egl Nine Homolog 1 (EGLN1) Protein
20-abx653238	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Egl Nine Homolog 1 (EGLN1) CLIA Kit
20-abx495955	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Egl Nine Homolog 1 (EGLN1)ELISA Kit
201-12-2501	SunredBio	96 tests	EUR 440
This Egl Nine Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit
GA-E0941RT-48T	GenAsia Biotech	48T	EUR 317

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit
GA-E0941RT-96T	GenAsia Biotech	96T	EUR 496

Human Egl nine homolog 1, EGLN1 ELISA KIT
ELI-32637h	Lifescience Market	96 Tests	EUR 824

Human Egl Nine Homolog 1(EGLN1)ELISA Kit
QY-E04950	Qayee Biotechnology	96T	EUR 361

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit
QY-E10711	Qayee Biotechnology	96T	EUR 361

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
4-SEL644Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3 HIFPH2 PHD2 C1orf12 SM20 ZMYND6 HIF Prolyl Hydroxylase 2 Prolyl hydroxylase domain-containing protein 2 Hypoxia-inducible factor prolyl hydroxylase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Egl Nine Homolog 1 (EGLN1) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse EGLN1 (Egl Nine Homolog 1)
ELK7994	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin Show more
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)
KTE71217-48T	Abbkine	48T	EUR 332
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)
KTE71217-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)
KTE71217-96T	Abbkine	96T	EUR 539
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) Protein
20-abx653239	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Egl nine homolog 1 (EGLN1) polyclonal antibody
ABP-PAB-11633	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Human Egl Nine Homolog 1 (EGLN1) CLIA Kit
20-abx495954	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human EGLN1 (Egl Nine Homolog 1)
ELK7299	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin Show more
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)
KTE61942-48T	Abbkine	48T	EUR 354
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)
KTE61942-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)
KTE61942-96T	Abbkine	96T	EUR 572
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Egl Nine-Like Protein 1 (EGLN1) ELISA Kit
20-abx153943	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Egl Nine-Like Protein 1 (EGLN1) ELISA Kit
20-abx151386	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Egl nine homolog 2 Antibody
20-abx109745	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 3 Antibody
20-abx109746	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl Nine Homolog 3 Protein
20-abx263290	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Mouse Egl nine homolog 2, Egln2 ELISA KIT
ELI-09617m	Lifescience Market	96 Tests	EUR 865

Mouse Egl nine homolog 3, Egln3 ELISA KIT
ELI-08646m	Lifescience Market	96 Tests	EUR 865

Mouse Egl nine homolog 3 protein (Egln3)
1-CSB-RP147974m	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 31.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Egl nine homolog 3 protein(Egln3) expressed in E.coli

Human Egl Nine Homolog 2 (EGLN2) ELISA Kit
abx259775-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Egl nine homolog 2, EGLN2 ELISA KIT
ELI-26924h	Lifescience Market	96 Tests	EUR 824

Human Egl nine homolog 3, EGLN3 ELISA KIT
ELI-47060h	Lifescience Market	96 Tests	EUR 824

Human Egl nine homolog 2 (EGLN2)
1-CSB-EP007482HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 18.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Egl nine homolog 2(EGLN2),partial expressed in E.coli

Egl nine homolog 2 Antibody (Biotin)
20-abx105369	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (Biotin)
20-abx105370	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 2 Antibody (FITC)
20-abx106788	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (FITC)
20-abx106789	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 2 Antibody (HRP)
20-abx108207	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (HRP)
20-abx108208	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl Nine Homolog 2 (C. Elegans) Antibody
20-abx112251	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 3 (C. Elegans) Antibody
20-abx112252	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Egl nine homolog 2 (EGLN2) polyclonal antibody
ABP-PAB-11634	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Egl nine homolog 3 (EGLN3) polyclonal antibody
ABP-PAB-11635	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

EGLN3 Egl Nine Homolog 3 Human Recombinant Protein
PROTQ9H6Z9	BosterBio	Regular: 10ug	EUR 317
Description: EGLN3 Human Recombinant produced in E. coli is a single polypeptide chain containing 263 amino acids (1-239) and having a molecular mass of 29.8 kDa.;EGLN3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-100ug
QP8813-ec-100ug	EnQuireBio	100ug	EUR 571

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-10ug
QP8813-ec-10ug	EnQuireBio	10ug	EUR 272

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-1mg
QP8813-ec-1mg	EnQuireBio	1mg	EUR 2303

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-200ug
QP8813-ec-200ug	EnQuireBio	200ug	EUR 898

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-500ug
QP8813-ec-500ug	EnQuireBio	500ug	EUR 1514

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-50ug
QP8813-ec-50ug	EnQuireBio	50ug	EUR 362

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-100ug
QP5968-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug
QP5968-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-1mg
QP5968-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-200ug
QP5968-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-500ug
QP5968-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-50ug
QP5968-ec-50ug	EnQuireBio	50ug	EUR 263

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Egln1/ Rat Egln1 ELISA Kit
ELI-09616r	Lifescience Market	96 Tests	EUR 886

Mouse EGLN1 shRNA Plasmid
20-abx980130	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EGLN1 Recombinant Protein (Mouse)
RP131087	ABM	100 ug	Ask for price

EGLN1 antibody
70R-17019	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EGLN1 antibody

EGLN1 Antibody
32185-100ul	SAB	100ul	EUR 252

EGLN1 antibody
10R-1165	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal EGLN1 antibody

EGLN1 Antibody
6151-100	Biovision		EUR 414

EGLN1 Antibody
42722-100ul	SAB	100ul	EUR 252

EGLN1 Antibody
1-CSB-PA958222	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

EGLN1 Antibody
1-CSB-PA863932ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EGLN1 Antibody
1-CSB-PA863932ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

EGLN1 Antibody
DF6285	Affbiotech	200ul	EUR 304
Description: EGLN1 Antibody detects endogenous levels of total EGLN1.

EGLN1 Antibody
1-CSB-PA519093	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

EGLN1 Antibody
1-CSB-PA007481GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EGLN1 siRNA
20-abx915075	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EGLN1 siRNA
20-abx915076	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EGLN1 Antibody
ABD6285	Lifescience Market	100 ug	EUR 438

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Egln1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4460802	ABM	1.0 ug DNA	EUR 154

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Mouse Notch Homolog 1 ELISA kit
E03N0594-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Notch Homolog 1 ELISA kit
E03N0594-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Notch Homolog 1 ELISA kit
E03N0594-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Egln1 ORF Vector (Mouse) (pORF)
ORF043697	ABM	1.0 ug DNA	EUR 506

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

EGLN1 Blocking Peptide
DF6285-BP	Affbiotech	1mg	EUR 195

EGLN1 Polyclonal Antibody
A-2702	EpiGentek	100 µl	EUR 483.55
Description: fast delivery possible

EGLN1 / EGLN2 Antibody
20-abx125802	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

EGLN1 Conjugated Antibody
C32185	SAB	100ul	EUR 397

Polyclonal EGLN1 Antibody
APR07662G	Leading Biology	0.1mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGLN1 . This antibody is tested and proven to work in the following applications:

EGLN1 cloning plasmid
CSB-CL863932HU-10ug	Cusabio	10ug	EUR 217
Formulation: 10 μg plasmid + 200μl Glycerol Length: 387 Sequence: atggttgcttgttatccgggcaatggaacgggttatgtacgtcatgttgataatccaaatggagatggaagatgtgtgacatgtatatattatcttaataaagactgggatgccaaggtaagtggaggtatacttcgaatttttccagaaggcaaagcccagtttgctgacattga Show more
Description: A cloning plasmid for the EGLN1 gene.

EGLN1 Rabbit pAb
A2314-100ul	Abclonal	100 ul	EUR 308

EGLN1 Rabbit pAb
A2314-200ul	Abclonal	200 ul	EUR 459

EGLN1 Rabbit pAb
A2314-20ul	Abclonal	20 ul	EUR 183

EGLN1 Rabbit pAb
A2314-50ul	Abclonal	50 ul	EUR 223

anti- EGLN1 antibody
FNab10184	FN Test	100µg	EUR 505.25
Recommended dilution: IHC: 1:50-1:500 Immunogen: Egl nine homolog 1 Uniprot ID: Q9GZT9 Gene ID: 54583
Description: Antibody raised against EGLN1

Anti-EGLN1 antibody
STJ116175	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

Anti-EGLN1 antibody
STJ116768	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

Anti-EGLN1 antibody
STJ23492	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
DLR-MSTO1-Mu-48T	DL Develop	48T	EUR 566
Should the Mouse Misato Homolog 1 (MSTO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Misato Homolog 1 (MSTO1) in samples from tissue homogenates or other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
DLR-MSTO1-Mu-96T	DL Develop	96T	EUR 741
Should the Mouse Misato Homolog 1 (MSTO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Misato Homolog 1 (MSTO1) in samples from tissue homogenates or other biological fluids.

Mouse Dab1/ Disabled homolog 1 ELISA Kit
E0377Mo	Sunlong	1 Kit	EUR 632

Mouse Achaete scute homolog 1 ELISA kit
E03A0079-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Achaete scute homolog 1 ELISA kit
E03A0079-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Achaete scute homolog 1 ELISA kit
E03A0079-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crumbs homolog 1(CRB1) ELISA kit
E03C2038-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crumbs homolog 1(CRB1) ELISA kit
E03C2038-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Crumbs homolog 1(CRB1) ELISA kit
E03C2038-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit
E03P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit
E03P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit
E03P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit
20-abx153918	Abbexa	EUR 5640.00 EUR 3009.00 EUR 707.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
20-abx154390	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Slit Homolog 1 (Slit1) ELISA Kit
20-abx154688	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit
abx254020-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

ELISA kit for Mouse Disabled homolog 1
EK3038	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Robo1/ Roundabout homolog 1 ELISA Kit
E1276Mo	Sunlong	1 Kit	EUR 632

Mouse Nanos homolog 1, Nanos1 ELISA KIT
ELI-22326m	Lifescience Market	96 Tests	EUR 865

Mouse Pygopus homolog 1, Pygo1 ELISA KIT
ELI-30536m	Lifescience Market	96 Tests	EUR 865

Mouse Disabled homolog 1, Dab1 ELISA KIT
ELI-04119m	Lifescience Market	96 Tests	EUR 865

Mouse Dachshund homolog 1, Dach1 ELISA KIT
ELI-07865m	Lifescience Market	96 Tests	EUR 865

Mouse Teashirt homolog 1, Tshz1 ELISA KIT
ELI-51860m	Lifescience Market	96 Tests	EUR 865

Mouse Roundabout homolog 1 (ROBO1) ELISA Kit
abx555892-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Dachshund Homolog 1 (DACH1) ELISA Kit
abx556123-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse Frizzled Homolog 1 (FZD1) ELISA Kit
abx515256-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Nitrilase homolog 1 (NIT1) ELISA Kit
abx390062-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Dab1(Disabled homolog 1) ELISA Kit
EM0551	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: P97318 Alias: Dab1/DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Mouse Dapper homolog 1, Dact1 ELISA KIT
ELI-31901m	Lifescience Market	96 Tests	EUR 865

Mouse Nitrilase homolog 1, Nit1 ELISA KIT
ELI-35327m	Lifescience Market	96 Tests	EUR 865

Mouse Roundabout homolog 1, Robo1 ELISA KIT
ELI-38645m	Lifescience Market	96 Tests	EUR 865

Mouse Pumilio homolog 1, Pum1 ELISA KIT
ELI-36786m	Lifescience Market	96 Tests	EUR 865

Mouse Crumbs homolog 1, Crb1 ELISA KIT
ELI-47518m	Lifescience Market	96 Tests	EUR 865

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RDR-DAB1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RDR-DAB1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Slit Homolog 1 (Slit1) ELISA Kit
RD-Slit1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Slit Homolog 1 (Slit1) ELISA Kit
RD-Slit1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Slit Homolog 1 (Slit1) ELISA Kit
SED354Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit
SED354Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit
SED354Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit
SED354Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Slit Homolog 1 (Slit1) ELISA Kit
4-SED354Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Slit Homolog 1 elisa. Alternative names of the recognized antigen: MEGF4 SLIL1 SLIT3 Multiple epidermal growth factor-like domains protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Slit Homolog 1 (Slit1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
RDR-MSTO1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 603

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
RDR-MSTO1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 840

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RD-DAB1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RD-DAB1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Disabled Homolog 1(DAB1)ELISA Kit
QY-E20475	Qayee Biotechnology	96T	EUR 361

Mouse Frizzled Homolog 1(FZD1)ELISA Kit
QY-E20616	Qayee Biotechnology	96T	EUR 361

Mouse Slit Homolog 1 (Slit1) ELISA Kit
RDR-Slit1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Slit Homolog 1 (Slit1) ELISA Kit
RDR-Slit1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
RD-MSTO1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 577

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
RD-MSTO1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
SES031Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5333.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
SES031Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 526.89
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
SES031Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 709.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
SES031Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2894.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.

Mouse Misato Homolog 1 (MSTO1) ELISA Kit
4-SES031Mu	Cloud-Clone	EUR 5384.00 EUR 2845.00 EUR 710.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Misato Homolog 1 elisa. Alternative names of the recognized antigen: MST
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Misato Homolog 1 (MSTO1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Dach1 ELISA Kit| Mouse Dachshund homolog 1 ELISA Kit
EF014622	Lifescience Market	96 Tests	EUR 689

Nit1 ELISA Kit| Mouse Nitrilase homolog 1 ELISA Kit
EF015701	Lifescience Market	96 Tests	EUR 689

Dab1 ELISA Kit| Mouse Disabled homolog 1 ELISA Kit
EF013178	Lifescience Market	96 Tests	EUR 689

Egln1 sgRNA CRISPR Lentivector set (Mouse)
K4460801	ABM	3 x 1.0 ug	EUR 339

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse Protein sel- 1 homolog 1, Sel1l ELISA KIT
ELI-42374m	Lifescience Market	96 Tests	EUR 865

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

EGLN1/EGLN2 Polyclonal Antibody
27387-100ul	SAB	100ul	EUR 252

EGLN1/EGLN2 Polyclonal Antibody
27387-50ul	SAB	50ul	EUR 187

EGLN1/EGLN2 Rabbit pAb
A10342-100ul	Abclonal	100 ul	EUR 308

EGLN1/EGLN2 Rabbit pAb
A10342-200ul	Abclonal	200 ul	EUR 459

EGLN1/EGLN2 Rabbit pAb
A10342-20ul	Abclonal	20 ul	EUR 183

EGLN1/EGLN2 Rabbit pAb
A10342-50ul	Abclonal	50 ul	EUR 223

EGLN1 Polyclonal Conjugated Antibody
C28620	SAB	100ul	EUR 397

Human EGLN1 shRNA Plasmid
20-abx960144	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EGLN1 Recombinant Protein (Human)
RP010303	ABM	100 ug	Ask for price

Anti-EGLN1/EGLN2 antibody
STJ112380	St John's Laboratory	100 µl	EUR 277

Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EMI2200-1	AssayPro	96 Well Plate	EUR 477

Mouse Snail Homolog ELISA kit
E03S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Snail Homolog ELISA kit
E03S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Snail Homolog ELISA kit
E03S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ascl1 ELISA Kit| Mouse Achaete-scute homolog 1 ELISA Kit
EF014112	Lifescience Market	96 Tests	EUR 689

Cby1 ELISA Kit| Mouse Protein chibby homolog 1 ELISA Kit
EF014473	Lifescience Market	96 Tests	EUR 689

Disp1 ELISA Kit| Mouse Protein dispatched homolog 1 ELISA Kit
EF014711	Lifescience Market	96 Tests	EUR 689

Jagn1 ELISA Kit| Mouse Protein jagunal homolog 1 ELISA Kit
EF015301	Lifescience Market	96 Tests	EUR 689

Msto1 ELISA Kit| Mouse Protein misato homolog 1 ELISA Kit
EF015532	Lifescience Market	96 Tests	EUR 689

Ptch1 ELISA Kit| Mouse Protein patched homolog 1 ELISA Kit
EF015804	Lifescience Market	96 Tests	EUR 689

Sav1 ELISA Kit| Mouse Protein salvador homolog 1 ELISA Kit
EF016133	Lifescience Market	96 Tests	EUR 689

Fermt1 ELISA Kit| Mouse Fermitin family homolog 1 ELISA Kit
EF013237	Lifescience Market	96 Tests	EUR 689

EGLN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0662402	ABM	1.0 ug DNA	EUR 154

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Mouse Delta Like 1 Homolog (dLK1) ELISA Kit
DLR-dLK1-Mu-48T	DL Develop	48T	EUR 566
Should the Mouse Delta Like 1 Homolog (dLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Delta Like 1 Homolog (dLK1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Delta Like 1 Homolog (dLK1) ELISA Kit
DLR-dLK1-Mu-96T	DL Develop	96T	EUR 741
Should the Mouse Delta Like 1 Homolog (dLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Delta Like 1 Homolog (dLK1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Fermt1/ Fermitin family homolog 1 ELISA Kit
E0522Mo	Sunlong	1 Kit	EUR 632

Mouse Dlk1/ Protein delta homolog 1 ELISA Kit
E0406Mo	Sunlong	1 Kit	EUR 571

Mouse seminal plasma protein homolog 1 ELISA kit
E03B0856-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse seminal plasma protein homolog 1 ELISA kit
E03B0856-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse seminal plasma protein homolog 1 ELISA kit
E03B0856-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chromobox protein homolog 1(CBX1) ELISA kit
E03C1420-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chromobox protein homolog 1(CBX1) ELISA kit
E03C1420-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chromobox protein homolog 1(CBX1) ELISA kit
E03C1420-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit
E03S0269-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit
E03S0269-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit
E03S0269-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse delta Like 1 Homolog (dLK1) ELISA Kit
20-abx153909	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit
abx254902-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Fermitin Family Homolog 1 (FERMT1) ELISA Kit
abx254968-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Mouse Fermitin family homolog 1
EK3461	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Fermitin family homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Protein misato homolog 1, Msto1 ELISA KIT
ELI-12984m	Lifescience Market	96 Tests	EUR 865

Mouse Protein Hook homolog 1, Hook1 ELISA KIT
ELI-13075m	Lifescience Market	96 Tests	EUR 865

Mouse Protein tweety homolog 1, Ttyh1 ELISA KIT
ELI-17045m	Lifescience Market	96 Tests	EUR 865

Mouse Protein canopy homolog 1, Cnpy1 ELISA KIT
ELI-09145m	Lifescience Market	96 Tests	EUR 865

Mouse Disks large homolog 1, Dlg1 ELISA KIT
ELI-09200m	Lifescience Market	96 Tests	EUR 865

Mouse Chromobox protein homolog 1, Cbx1 ELISA KIT
ELI-10762m	Lifescience Market	96 Tests	EUR 865

Mouse EGLN1(Egl Nine Homolog 1) ELISA Kit