Mouse EGLN1(Egl Nine Homolog 1) ELISA Kit
To Order Contact us: [email protected]
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
RD-EGLN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
4-SEL644Mu |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
- HIFPH2
- PHD2
- C1orf12
- SM20
- ZMYND6
- HIF Prolyl Hydroxylase 2
- Prolyl hydroxylase domain-containing protein 2
- Hypoxia-inducible factor prolyl hydroxylase 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx112250 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx001065 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx137353 |
Abbexa |
-
EUR 704.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx141591 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
abx030444-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
abx030444-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx172198 |
Abbexa |
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx176226 |
Abbexa |
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx176227 |
Abbexa |
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx176228 |
Abbexa |
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx320187 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx320188 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx321661 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx322731 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx241216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx213651 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse Egl Nine Homolog 1 (EGLN1) Protein |
20-abx653237 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Egl Nine Homolog 1 (EGLN1) Protein |
20-abx653238 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Egl Nine Homolog 1 (EGLN1) CLIA Kit |
20-abx495955 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Egl Nine Homolog 1(EGLN1)ELISA Kit |
GA-E0941RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat Egl Nine Homolog 1(EGLN1)ELISA Kit |
GA-E0941RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
Human Egl Nine Homolog 1 (EGLN1)ELISA Kit |
201-12-2501 |
SunredBio |
96 tests |
EUR 440 |
- This Egl Nine Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
4-SEL644Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
- HIFPH2
- PHD2
- C1orf12
- SM20
- ZMYND6
- HIF Prolyl Hydroxylase 2
- Prolyl hydroxylase domain-containing protein 2
- Hypoxia-inducible factor prolyl hydroxylase 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Egl Nine Homolog 1 (EGLN1) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse EGLN1 (Egl Nine Homolog 1) |
ELK7994 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
- Show more
|
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Egl nine homolog 1 (EGLN1) |
KTE71217-48T |
Abbkine |
48T |
EUR 332 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Egl nine homolog 1 (EGLN1) |
KTE71217-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Egl nine homolog 1 (EGLN1) |
KTE71217-96T |
Abbkine |
96T |
EUR 539 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) Protein |
20-abx653239 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Egl nine homolog 1 (EGLN1) polyclonal antibody |
ABP-PAB-11633 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
Human Egl Nine Homolog 1 (EGLN1) CLIA Kit |
20-abx495954 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human EGLN1 (Egl Nine Homolog 1) |
ELK7299 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
- Show more
|
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Egl nine homolog 1 (EGLN1) |
KTE61942-48T |
Abbkine |
48T |
EUR 354 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Egl nine homolog 1 (EGLN1) |
KTE61942-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Egl nine homolog 1 (EGLN1) |
KTE61942-96T |
Abbkine |
96T |
EUR 572 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Egl Nine-Like Protein 1 (EGLN1) ELISA Kit |
20-abx153943 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Egl Nine-Like Protein 1 (EGLN1) ELISA Kit |
20-abx151386 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Egl nine homolog 2 Antibody |
20-abx109745 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 3 Antibody |
20-abx109746 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 3 Protein |
20-abx263290 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Mouse Egl nine homolog 3 protein (Egln3) |
1-CSB-RP147974m |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 31.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Egl nine homolog 3 protein(Egln3) expressed in E.coli |
Egl nine homolog 2 Antibody (HRP) |
20-abx108207 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 3 Antibody (HRP) |
20-abx108208 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 2 Antibody (Biotin) |
20-abx105369 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 3 Antibody (Biotin) |
20-abx105370 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 2 Antibody (FITC) |
20-abx106788 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 3 Antibody (FITC) |
20-abx106789 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Egl nine homolog 2 (EGLN2) |
1-CSB-EP007482HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 18.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Egl nine homolog 2(EGLN2),partial expressed in E.coli |
Human Egl Nine Homolog 2 (EGLN2) ELISA Kit |
abx259775-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Egl Nine Homolog 2 (C. Elegans) Antibody |
20-abx112251 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 3 (C. Elegans) Antibody |
20-abx112252 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl nine homolog 2 (EGLN2) polyclonal antibody |
ABP-PAB-11634 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
Egl nine homolog 3 (EGLN3) polyclonal antibody |
ABP-PAB-11635 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
EGLN3 Egl Nine Homolog 3 Human Recombinant Protein |
PROTQ9H6Z9 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: EGLN3 Human Recombinant produced in E. coli is a single polypeptide chain containing 263 amino acids (1-239) and having a molecular mass of 29.8 kDa.;EGLN3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-100ug |
QP8813-ec-100ug |
EnQuireBio |
100ug |
EUR 571 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-10ug |
QP8813-ec-10ug |
EnQuireBio |
10ug |
EUR 272 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-1mg |
QP8813-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-200ug |
QP8813-ec-200ug |
EnQuireBio |
200ug |
EUR 898 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-500ug |
QP8813-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-50ug |
QP8813-ec-50ug |
EnQuireBio |
50ug |
EUR 362 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-100ug |
QP5968-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug |
QP5968-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-1mg |
QP5968-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-200ug |
QP5968-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-500ug |
QP5968-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-50ug |
QP5968-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Egln1 ELISA Kit (Mouse) (OKCD02055) |
OKCD02055 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL |
EGLN1 ELISA Kit (Human) (OKCD02054) |
OKCD02054 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.2 pg/mL |
EGLN1 ELISA Kit (Human) (OKCA02095) |
OKCA02095 |
Aviva Systems Biology |
96 Wells |
EUR 917 |
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL |
Mouse EGLN1 shRNA Plasmid |
20-abx980130 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EGLN1 Recombinant Protein (Mouse) |
RP131087 |
ABM |
100 ug |
Ask for price |
EGLN1 siRNA |
20-abx915075 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGLN1 siRNA |
20-abx915076 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGLN1 Antibody |
42722-100ul |
SAB |
100ul |
EUR 252 |
EGLN1 antibody |
10R-1165 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal EGLN1 antibody |
EGLN1 Antibody |
32185-100ul |
SAB |
100ul |
EUR 252 |
EGLN1 antibody |
70R-17019 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EGLN1 antibody |
EGLN1 Antibody |
DF6285 |
Affbiotech |
200ul |
EUR 304 |
Description: EGLN1 Antibody detects endogenous levels of total EGLN1. |
EGLN1 Antibody |
1-CSB-PA958222 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50 |
EGLN1 Antibody |
1-CSB-PA007481GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
EGLN1 Antibody |
1-CSB-PA519093 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
EGLN1 Antibody |
1-CSB-PA863932ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
EGLN1 Antibody |
1-CSB-PA863932ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Egln1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4460802 |
ABM |
1.0 ug DNA |
EUR 154 |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Mouse Notch Homolog 1 ELISA kit |
E03N0594-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Notch Homolog 1 ELISA kit |
E03N0594-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Notch Homolog 1 ELISA kit |
E03N0594-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Egln1 ORF Vector (Mouse) (pORF) |
ORF043697 |
ABM |
1.0 ug DNA |
EUR 506 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
Polyclonal EGLN1 Antibody |
APR07662G |
Leading Biology |
0.1mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGLN1 . This antibody is tested and proven to work in the following applications: |
EGLN1 Conjugated Antibody |
C32185 |
SAB |
100ul |
EUR 397 |
anti- EGLN1 antibody |
FNab10184 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: IHC: 1:50-1:500
- Immunogen: Egl nine homolog 1
- Uniprot ID: Q9GZT9
- Gene ID: 54583
|
Description: Antibody raised against EGLN1 |
EGLN1 / EGLN2 Antibody |
20-abx125802 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
EGLN1 Polyclonal Antibody |
A-2702 |
EpiGentek |
100 µl |
EUR 483.55 |
Description: fast delivery possible |
EGLN1 Rabbit pAb |
A2314-100ul |
Abclonal |
100 ul |
EUR 308 |
EGLN1 Rabbit pAb |
A2314-200ul |
Abclonal |
200 ul |
EUR 459 |
EGLN1 Rabbit pAb |
A2314-20ul |
Abclonal |
20 ul |
EUR 183 |
EGLN1 Rabbit pAb |
A2314-50ul |
Abclonal |
50 ul |
EUR 223 |
EGLN1 cloning plasmid |
CSB-CL863932HU-10ug |
Cusabio |
10ug |
EUR 217 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 387
- Sequence: atggttgcttgttatccgggcaatggaacgggttatgtacgtcatgttgataatccaaatggagatggaagatgtgtgacatgtatatattatcttaataaagactgggatgccaaggtaagtggaggtatacttcgaatttttccagaaggcaaagcccagtttgctgacattga
- Show more
|
Description: A cloning plasmid for the EGLN1 gene. |
EGLN1 Blocking Peptide |
DF6285-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-EGLN1 antibody |
STJ23492 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). |
Anti-EGLN1 antibody |
STJ116175 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). |
Anti-EGLN1 antibody |
STJ116768 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Anti-CELSR3/Flamingo Homolog 1 Antibody |
A07204-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat. |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Mouse Roundabout homolog 1 (ROBO1) ELISA Kit |
abx555892-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Dachshund Homolog 1 (DACH1) ELISA Kit |
abx556123-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Mouse Frizzled Homolog 1 (FZD1) ELISA Kit |
abx515256-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Crumbs homolog 1(CRB1) ELISA kit |
E03C2038-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Crumbs homolog 1(CRB1) ELISA kit |
E03C2038-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Crumbs homolog 1(CRB1) ELISA kit |
E03C2038-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Achaete scute homolog 1 ELISA kit |
E03A0079-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Achaete scute homolog 1 ELISA kit |
E03A0079-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Achaete scute homolog 1 ELISA kit |
E03A0079-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
E03P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
E03P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
E03P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dab1/ Disabled homolog 1 ELISA Kit |
E0377Mo |
Sunlong |
1 Kit |
EUR 632 |
ELISA kit for Mouse Disabled homolog 1 |
EK3038 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Robo1/ Roundabout homolog 1 ELISA Kit |
E1276Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse Roundabout homolog 1, Robo1 ELISA KIT |
ELI-38645m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Dab1(Disabled homolog 1) ELISA Kit |
EM0551 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.78-50 ng/ml
- Uniprot ID: P97318
- Alias: Dab1/DAB1/Disabled homolog 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml |
Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit |
20-abx153918 |
Abbexa |
-
EUR 5640.00
-
EUR 3009.00
-
EUR 707.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
20-abx154390 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
20-abx154688 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit |
abx254020-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Mouse Nitrilase homolog 1 (NIT1) ELISA Kit |
abx390062-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
DLR-Slit1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
DLR-Slit1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
DLR-MSTO1-Mu-48T |
DL Develop |
48T |
EUR 566 |
- Should the Mouse Misato Homolog 1 (MSTO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Misato Homolog 1 (MSTO1) in samples from tissue homogenates or other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
DLR-MSTO1-Mu-96T |
DL Develop |
96T |
EUR 741 |
- Should the Mouse Misato Homolog 1 (MSTO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Misato Homolog 1 (MSTO1) in samples from tissue homogenates or other biological fluids. |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
DLR-DAB1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
DLR-DAB1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
RD-MSTO1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
RD-MSTO1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
RD-Slit1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
RD-Slit1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RDR-DAB1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RDR-DAB1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
RDR-MSTO1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
RDR-MSTO1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RD-DAB1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RD-DAB1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
RDR-Slit1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
RDR-Slit1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
SED354Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
SED354Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
SED354Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
SED354Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Slit Homolog 1 (Slit1) ELISA Kit |
4-SED354Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Slit Homolog 1 elisa. Alternative names of the recognized antigen: MEGF4
- SLIL1
- SLIT3
- Multiple epidermal growth factor-like domains protein 4
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Slit Homolog 1 (Slit1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
SES031Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
SES031Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
SES031Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
SES031Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids. |
Mouse Misato Homolog 1 (MSTO1) ELISA Kit |
4-SES031Mu |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Misato Homolog 1 elisa. Alternative names of the recognized antigen: MST
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Misato Homolog 1 (MSTO1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Egln1 sgRNA CRISPR Lentivector set (Mouse) |
K4460801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dach1 ELISA Kit| Mouse Dachshund homolog 1 ELISA Kit |
EF014622 |
Lifescience Market |
96 Tests |
EUR 689 |
Nit1 ELISA Kit| Mouse Nitrilase homolog 1 ELISA Kit |
EF015701 |
Lifescience Market |
96 Tests |
EUR 689 |
Dab1 ELISA Kit| Mouse Disabled homolog 1 ELISA Kit |
EF013178 |
Lifescience Market |
96 Tests |
EUR 689 |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
EGLN1 Polyclonal Conjugated Antibody |
C28620 |
SAB |
100ul |
EUR 397 |
Human EGLN1 shRNA Plasmid |
20-abx960144 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EGLN1/EGLN2 Rabbit pAb |
A10342-100ul |
Abclonal |
100 ul |
EUR 308 |
EGLN1/EGLN2 Rabbit pAb |
A10342-200ul |
Abclonal |
200 ul |
EUR 459 |
EGLN1/EGLN2 Rabbit pAb |
A10342-20ul |
Abclonal |
20 ul |
EUR 183 |
EGLN1/EGLN2 Rabbit pAb |
A10342-50ul |
Abclonal |
50 ul |
EUR 223 |
EGLN1/EGLN2 Polyclonal Antibody |
27387-100ul |
SAB |
100ul |
EUR 252 |
EGLN1/EGLN2 Polyclonal Antibody |
27387-50ul |
SAB |
50ul |
EUR 187 |
EGLN1 Recombinant Protein (Human) |
RP010303 |
ABM |
100 ug |
Ask for price |
Mouse Protein sel- 1 homolog 1, Sel1l ELISA KIT |
ELI-42374m |
Lifescience Market |
96 Tests |
EUR 865 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit |
EMI2200-1 |
AssayPro |
96 Well Plate |
EUR 477 |
EGLN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0662402 |
ABM |
1.0 ug DNA |
EUR 154 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Mouse Snail Homolog ELISA kit |
E03S0441-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Snail Homolog ELISA kit |
E03S0441-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Snail Homolog ELISA kit |
E03S0441-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Disp1 ELISA Kit| Mouse Protein dispatched homolog 1 ELISA Kit |
EF014711 |
Lifescience Market |
96 Tests |
EUR 689 |
Jagn1 ELISA Kit| Mouse Protein jagunal homolog 1 ELISA Kit |
EF015301 |
Lifescience Market |
96 Tests |
EUR 689 |
Msto1 ELISA Kit| Mouse Protein misato homolog 1 ELISA Kit |
EF015532 |
Lifescience Market |
96 Tests |
EUR 689 |
Ptch1 ELISA Kit| Mouse Protein patched homolog 1 ELISA Kit |
EF015804 |
Lifescience Market |
96 Tests |
EUR 689 |
Sav1 ELISA Kit| Mouse Protein salvador homolog 1 ELISA Kit |
EF016133 |
Lifescience Market |
96 Tests |
EUR 689 |
Fermt1 ELISA Kit| Mouse Fermitin family homolog 1 ELISA Kit |
EF013237 |
Lifescience Market |
96 Tests |
EUR 689 |
Ascl1 ELISA Kit| Mouse Achaete-scute homolog 1 ELISA Kit |
EF014112 |
Lifescience Market |
96 Tests |
EUR 689 |
Cby1 ELISA Kit| Mouse Protein chibby homolog 1 ELISA Kit |
EF014473 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse Achaete-Scute Homolog 1 (ASCL1) ELISA Kit |
abx555606-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Protein Atonal Homolog 1 (ATOH1) ELISA Kit |
abx512375-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Protein delta homolog 1 (DLK1) ELISA Kit |
abx574066-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Dlk1/ Protein delta homolog 1 ELISA Kit |
E0406Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse seminal plasma protein homolog 1 ELISA kit |
E03B0856-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse seminal plasma protein homolog 1 ELISA kit |
E03B0856-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse seminal plasma protein homolog 1 ELISA kit |
E03B0856-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Chromobox protein homolog 1(CBX1) ELISA kit |
E03C1420-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Chromobox protein homolog 1(CBX1) ELISA kit |
E03C1420-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Chromobox protein homolog 1(CBX1) ELISA kit |
E03C1420-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit |
E03S0269-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit |
E03S0269-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit |
E03S0269-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Fermt1/ Fermitin family homolog 1 ELISA Kit |
E0522Mo |
Sunlong |
1 Kit |
EUR 632 |
ELISA kit for Mouse Fermitin family homolog 1 |
EK3461 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Fermitin family homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Chromobox protein homolog 1, Cbx1 ELISA KIT |
ELI-10762m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein misato homolog 1, Msto1 ELISA KIT |
ELI-12984m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein Hook homolog 1, Hook1 ELISA KIT |
ELI-13075m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Slit homolog 1 protein, Slit1 ELISA KIT |
ELI-18718m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Single- minded homolog 1, Sim1 ELISA KIT |
ELI-19165m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse EGLN1(Egl Nine Homolog 1) ELISA Kit