Mouse EGLN1(Egl Nine Homolog 1) ELISA Kit

Mouse EGLN1(Egl Nine Homolog 1) ELISA Kit

To Order Contact us: [email protected]

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
RD-EGLN1-Mu-96Tests 96 Tests
EUR 802
Mouse Egl nine homolog 1, Egln1 ELISA KIT
ELI-32638m 96 Tests
EUR 865
Mouse Egl Nine Homolog 1(EGLN1)ELISA Kit
QY-E20507 96T
EUR 361
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
  • HIFPH2
  • PHD2
  • C1orf12
  • SM20
  • ZMYND6
  • HIF Prolyl Hydroxylase 2
  • Prolyl hydroxylase domain-containing protein 2
  • Hypoxia-inducible factor prolyl hydroxylase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
abx030444-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
abx030444-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Egl Nine Homolog 1 (EGLN1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mouse Egl Nine Homolog 1 (EGLN1) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Egl Nine Homolog 1 (EGLN1) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Egl Nine Homolog 1 (EGLN1) CLIA Kit
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Rat Egl Nine Homolog 1(EGLN1)ELISA Kit
GA-E0941RT-48T 48T
EUR 317
Rat Egl Nine Homolog 1(EGLN1)ELISA Kit
GA-E0941RT-96T 96T
EUR 496
Human Egl nine homolog 1, EGLN1 ELISA KIT
ELI-32637h 96 Tests
EUR 824
Human Egl Nine Homolog 1 (EGLN1)ELISA Kit
201-12-2501 96 tests
EUR 440
  • This Egl Nine Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Egl Nine Homolog 1(EGLN1)ELISA Kit
QY-E04950 96T
EUR 361
Rat Egl Nine Homolog 1(EGLN1)ELISA Kit
QY-E10711 96T
EUR 361
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
  • HIFPH2
  • PHD2
  • C1orf12
  • SM20
  • ZMYND6
  • HIF Prolyl Hydroxylase 2
  • Prolyl hydroxylase domain-containing protein 2
  • Hypoxia-inducible factor prolyl hydroxylase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Egl Nine Homolog 1 (EGLN1) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for Mouse EGLN1 (Egl Nine Homolog 1)
ELK7994 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
  • Show more
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Egl nine homolog 1 (EGLN1)
KTE71217-48T 48T
EUR 332
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Egl nine homolog 1 (EGLN1)
KTE71217-5platesof96wells 5 plates of 96 wells
EUR 2115
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Egl nine homolog 1 (EGLN1)
KTE71217-96T 96T
EUR 539
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Egl Nine Homolog 1 (EGLN1) Protein
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Egl nine homolog 1 (EGLN1) polyclonal antibody
ABP-PAB-11633 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
Human Egl Nine Homolog 1 (EGLN1) CLIA Kit
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human EGLN1 (Egl Nine Homolog 1)
ELK7299 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
  • Show more
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Egl nine homolog 1 (EGLN1)
KTE61942-48T 48T
EUR 354
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Egl nine homolog 1 (EGLN1)
KTE61942-5platesof96wells 5 plates of 96 wells
EUR 2252
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Egl nine homolog 1 (EGLN1)
KTE61942-96T 96T
EUR 572
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Egl Nine-Like Protein 1 (EGLN1) ELISA Kit
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Egl Nine-Like Protein 1 (EGLN1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Egl nine homolog 2 Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Egl nine homolog 3 Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Egl Nine Homolog 3 Protein
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.
Mouse Egl nine homolog 3, Egln3 ELISA KIT
ELI-08646m 96 Tests
EUR 865
Mouse Egl nine homolog 2, Egln2 ELISA KIT
ELI-09617m 96 Tests
EUR 865
Mouse Egl nine homolog 3 protein (Egln3)
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Egl nine homolog 3 protein(Egln3) expressed in E.coli
Egl nine homolog 2 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Egl nine homolog 3 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Egl nine homolog 2 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Egl nine homolog 3 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Egl nine homolog 2 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Egl nine homolog 3 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Egl nine homolog 2 (EGLN2)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Egl nine homolog 2(EGLN2),partial expressed in E.coli
Human Egl nine homolog 2, EGLN2 ELISA KIT
ELI-26924h 96 Tests
EUR 824
Human Egl nine homolog 3, EGLN3 ELISA KIT
ELI-47060h 96 Tests
EUR 824
Human Egl Nine Homolog 2 (EGLN2) ELISA Kit
abx259775-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Egl Nine Homolog 2 (C. Elegans) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Egl Nine Homolog 3 (C. Elegans) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Egl nine homolog 2 (EGLN2) polyclonal antibody
ABP-PAB-11634 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
Egl nine homolog 3 (EGLN3) polyclonal antibody
ABP-PAB-11635 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
EGLN3 Egl Nine Homolog 3 Human Recombinant Protein
PROTQ9H6Z9 Regular: 10ug
EUR 317
Description: EGLN3 Human Recombinant produced in E. coli is a single polypeptide chain containing 263 amino acids (1-239) and having a molecular mass of 29.8 kDa.;EGLN3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-100ug
QP8813-ec-100ug 100ug
EUR 571
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-10ug
QP8813-ec-10ug 10ug
EUR 272
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-1mg
QP8813-ec-1mg 1mg
EUR 2303
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-200ug
QP8813-ec-200ug 200ug
EUR 898
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-500ug
QP8813-ec-500ug 500ug
EUR 1514
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-50ug
QP8813-ec-50ug 50ug
EUR 362
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-100ug
QP5968-ec-100ug 100ug
EUR 408
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug
QP5968-ec-10ug 10ug
EUR 200
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-1mg
QP5968-ec-1mg 1mg
EUR 1632
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-200ug
QP5968-ec-200ug 200ug
EUR 634
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-500ug
QP5968-ec-500ug 500ug
EUR 1060
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-50ug
QP5968-ec-50ug 50ug
EUR 263
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Egln1/ Rat Egln1 ELISA Kit
ELI-09616r 96 Tests
EUR 886
Egln1 ELISA Kit (Mouse) (OKCD02055)
OKCD02055 96 Wells
EUR 936
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL
EGLN1 ELISA Kit (Human) (OKCD02054)
OKCD02054 96 Wells
EUR 909
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.2 pg/mL
EGLN1 ELISA Kit (Human) (OKCA02095)
OKCA02095 96 Wells
EUR 917
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL
Mouse EGLN1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EGLN1 Recombinant Protein (Mouse)
RP131087 100 ug Ask for price
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EGLN1 Antibody
ABD6285 100 ug
EUR 438
EGLN1 Antibody
42722-100ul 100ul
EUR 252
EGLN1 antibody
10R-1165 100 ul
EUR 316
Description: Mouse monoclonal EGLN1 antibody
EGLN1 Antibody
32185-100ul 100ul
EUR 252
EGLN1 Antibody
EUR 414
EGLN1 antibody
70R-17019 50 ul
EUR 435
Description: Rabbit polyclonal EGLN1 antibody
EGLN1 Antibody
DF6285 200ul
EUR 304
Description: EGLN1 Antibody detects endogenous levels of total EGLN1.
EGLN1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50
EGLN1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
EGLN1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
EGLN1 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
EGLN1 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
Egln1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4460802 1.0 ug DNA
EUR 154
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Mouse Notch Homolog 1 ELISA kit
E03N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Notch Homolog 1 ELISA kit
E03N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Notch Homolog 1 ELISA kit
E03N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Egln1 ORF Vector (Mouse) (pORF)
ORF043697 1.0 ug DNA
EUR 506
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
Polyclonal EGLN1 Antibody
APR07662G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGLN1 . This antibody is tested and proven to work in the following applications:
EGLN1 Conjugated Antibody
C32185 100ul
EUR 397
anti- EGLN1 antibody
FNab10184 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:50-1:500
  • Immunogen: Egl nine homolog 1
  • Uniprot ID: Q9GZT9
  • Gene ID: 54583
Description: Antibody raised against EGLN1
EGLN1 / EGLN2 Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
EGLN1 Polyclonal Antibody
A-2702 100 µl
EUR 483.55
Description: fast delivery possible
EGLN1 Rabbit pAb
A2314-100ul 100 ul
EUR 308
EGLN1 Rabbit pAb
A2314-200ul 200 ul
EUR 459
EGLN1 Rabbit pAb
A2314-20ul 20 ul
EUR 183
EGLN1 Rabbit pAb
A2314-50ul 50 ul
EUR 223
EGLN1 cloning plasmid
CSB-CL863932HU-10ug 10ug
EUR 217
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 387
  • Sequence: atggttgcttgttatccgggcaatggaacgggttatgtacgtcatgttgataatccaaatggagatggaagatgtgtgacatgtatatattatcttaataaagactgggatgccaaggtaagtggaggtatacttcgaatttttccagaaggcaaagcccagtttgctgacattga
  • Show more
Description: A cloning plasmid for the EGLN1 gene.
EGLN1 Blocking Peptide
DF6285-BP 1mg
EUR 195
Anti-EGLN1 antibody
STJ23492 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).
Anti-EGLN1 antibody
STJ116175 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).
Anti-EGLN1 antibody
STJ116768 100 µl
EUR 413
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
Mouse Roundabout homolog 1 (ROBO1) ELISA Kit
abx555892-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Dachshund Homolog 1 (DACH1) ELISA Kit
abx556123-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.
Mouse Frizzled Homolog 1 (FZD1) ELISA Kit
abx515256-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Mouse Crumbs homolog 1(CRB1) ELISA kit
E03C2038-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Crumbs homolog 1(CRB1) ELISA kit
E03C2038-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Crumbs homolog 1(CRB1) ELISA kit
E03C2038-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Achaete scute homolog 1 ELISA kit
E03A0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Achaete scute homolog 1 ELISA kit
E03A0079-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Achaete scute homolog 1 ELISA kit
E03A0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Protein pellino homolog 1 ELISA kit
E03P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Protein pellino homolog 1 ELISA kit
E03P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Protein pellino homolog 1 ELISA kit
E03P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Dab1/ Disabled homolog 1 ELISA Kit
E0377Mo 1 Kit
EUR 632
ELISA kit for Mouse Disabled homolog 1
EK3038 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Mouse Robo1/ Roundabout homolog 1 ELISA Kit
E1276Mo 1 Kit
EUR 632
Mouse Nanos homolog 1, Nanos1 ELISA KIT
ELI-22326m 96 Tests
EUR 865
Mouse Disabled homolog 1, Dab1 ELISA KIT
ELI-04119m 96 Tests
EUR 865
Mouse Dachshund homolog 1, Dach1 ELISA KIT
ELI-07865m 96 Tests
EUR 865
Mouse Teashirt homolog 1, Tshz1 ELISA KIT
ELI-51860m 96 Tests
EUR 865
Mouse Nitrilase homolog 1, Nit1 ELISA KIT
ELI-35327m 96 Tests
EUR 865
Mouse Pumilio homolog 1, Pum1 ELISA KIT
ELI-36786m 96 Tests
EUR 865
Mouse Crumbs homolog 1, Crb1 ELISA KIT
ELI-47518m 96 Tests
EUR 865
Mouse Pygopus homolog 1, Pygo1 ELISA KIT
ELI-30536m 96 Tests
EUR 865
Mouse Dapper homolog 1, Dact1 ELISA KIT
ELI-31901m 96 Tests
EUR 865
Mouse Roundabout homolog 1, Robo1 ELISA KIT
ELI-38645m 96 Tests
EUR 865
Mouse Dab1(Disabled homolog 1) ELISA Kit
EM0551 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: P97318
  • Alias: Dab1/DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml
Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit
  • EUR 5640.00
  • EUR 3009.00
  • EUR 707.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Slit Homolog 1 (Slit1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Dickkopf 1 Homolog (DKK1) ELISA Kit
abx254020-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Mouse Nitrilase homolog 1 (NIT1) ELISA Kit
abx390062-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Mu-48T 48T
EUR 527
  • Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Mu-96T 96T
EUR 688
  • Should the Mouse Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
DLR-MSTO1-Mu-48T 48T
EUR 566
  • Should the Mouse Misato Homolog 1 (MSTO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Misato Homolog 1 (MSTO1) in samples from tissue homogenates or other biological fluids.
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
DLR-MSTO1-Mu-96T 96T
EUR 741
  • Should the Mouse Misato Homolog 1 (MSTO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Misato Homolog 1 (MSTO1) in samples from tissue homogenates or other biological fluids.
Mouse Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Mu-48T 48T
EUR 527
  • Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.
Mouse Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Mu-96T 96T
EUR 688
  • Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
RD-MSTO1-Mu-48Tests 48 Tests
EUR 577
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
RD-MSTO1-Mu-96Tests 96 Tests
EUR 802
Mouse Slit Homolog 1 (Slit1) ELISA Kit
RD-Slit1-Mu-48Tests 48 Tests
EUR 533
Mouse Slit Homolog 1 (Slit1) ELISA Kit
RD-Slit1-Mu-96Tests 96 Tests
EUR 740
Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RDR-DAB1-Mu-48Tests 48 Tests
EUR 557
Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RDR-DAB1-Mu-96Tests 96 Tests
EUR 774
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
RDR-MSTO1-Mu-48Tests 48 Tests
EUR 603
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
RDR-MSTO1-Mu-96Tests 96 Tests
EUR 840
Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RD-DAB1-Mu-48Tests 48 Tests
EUR 533
Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RD-DAB1-Mu-96Tests 96 Tests
EUR 740
Mouse Slit Homolog 1 (Slit1) ELISA Kit
RDR-Slit1-Mu-48Tests 48 Tests
EUR 557
Mouse Slit Homolog 1 (Slit1) ELISA Kit
RDR-Slit1-Mu-96Tests 96 Tests
EUR 774
Mouse Disabled Homolog 1(DAB1)ELISA Kit
QY-E20475 96T
EUR 361
Mouse Frizzled Homolog 1(FZD1)ELISA Kit
QY-E20616 96T
EUR 361
Mouse Slit Homolog 1 (Slit1) ELISA Kit
SED354Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Slit Homolog 1 (Slit1) ELISA Kit
SED354Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Slit Homolog 1 (Slit1) ELISA Kit
SED354Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Slit Homolog 1 (Slit1) ELISA Kit
SED354Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Slit Homolog 1 (Slit1) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Slit Homolog 1 elisa. Alternative names of the recognized antigen: MEGF4
  • SLIL1
  • SLIT3
  • Multiple epidermal growth factor-like domains protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Slit Homolog 1 (Slit1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
SES031Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
SES031Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
SES031Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
SES031Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Misato Homolog 1 (MSTO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Misato Homolog 1 (MSTO1) in Tissue homogenates and other biological fluids.
Mouse Misato Homolog 1 (MSTO1) ELISA Kit
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Misato Homolog 1 elisa. Alternative names of the recognized antigen: MST
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Misato Homolog 1 (MSTO1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Egln1 sgRNA CRISPR Lentivector set (Mouse)
K4460801 3 x 1.0 ug
EUR 339
Dach1 ELISA Kit| Mouse Dachshund homolog 1 ELISA Kit
EF014622 96 Tests
EUR 689
Nit1 ELISA Kit| Mouse Nitrilase homolog 1 ELISA Kit
EF015701 96 Tests
EUR 689
Dab1 ELISA Kit| Mouse Disabled homolog 1 ELISA Kit
EF013178 96 Tests
EUR 689
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
EGLN1 Polyclonal Conjugated Antibody
C28620 100ul
EUR 397
Human EGLN1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EGLN1/EGLN2 Rabbit pAb
A10342-100ul 100 ul
EUR 308
EGLN1/EGLN2 Rabbit pAb
A10342-200ul 200 ul
EUR 459
EGLN1/EGLN2 Rabbit pAb
A10342-20ul 20 ul
EUR 183
EGLN1/EGLN2 Rabbit pAb
A10342-50ul 50 ul
EUR 223
EGLN1/EGLN2 Polyclonal Antibody
27387-100ul 100ul
EUR 252
EGLN1/EGLN2 Polyclonal Antibody
27387-50ul 50ul
EUR 187
EGLN1 Recombinant Protein (Human)
RP010303 100 ug Ask for price
Anti-EGLN1/EGLN2 antibody
STJ112380 100 µl
EUR 277
Mouse Protein sel- 1 homolog 1, Sel1l ELISA KIT
ELI-42374m 96 Tests
EUR 865
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EMI2200-1 96 Well Plate
EUR 477
EGLN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0662402 1.0 ug DNA
EUR 154
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Mouse Snail Homolog ELISA kit
E03S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Snail Homolog ELISA kit
E03S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Snail Homolog ELISA kit
E03S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Disp1 ELISA Kit| Mouse Protein dispatched homolog 1 ELISA Kit
EF014711 96 Tests
EUR 689
Jagn1 ELISA Kit| Mouse Protein jagunal homolog 1 ELISA Kit
EF015301 96 Tests
EUR 689
Msto1 ELISA Kit| Mouse Protein misato homolog 1 ELISA Kit
EF015532 96 Tests
EUR 689
Ptch1 ELISA Kit| Mouse Protein patched homolog 1 ELISA Kit
EF015804 96 Tests
EUR 689
Sav1 ELISA Kit| Mouse Protein salvador homolog 1 ELISA Kit
EF016133 96 Tests
EUR 689
Fermt1 ELISA Kit| Mouse Fermitin family homolog 1 ELISA Kit
EF013237 96 Tests
EUR 689
Ascl1 ELISA Kit| Mouse Achaete-scute homolog 1 ELISA Kit
EF014112 96 Tests
EUR 689
Cby1 ELISA Kit| Mouse Protein chibby homolog 1 ELISA Kit
EF014473 96 Tests
EUR 689
Mouse Achaete-Scute Homolog 1 (ASCL1) ELISA Kit
abx555606-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Mouse Protein Atonal Homolog 1 (ATOH1) ELISA Kit
abx512375-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Protein delta homolog 1 (DLK1) ELISA Kit
abx574066-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Dlk1/ Protein delta homolog 1 ELISA Kit
E0406Mo 1 Kit
EUR 571
Mouse seminal plasma protein homolog 1 ELISA kit
E03B0856-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse seminal plasma protein homolog 1 ELISA kit
E03B0856-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse seminal plasma protein homolog 1 ELISA kit
E03B0856-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Chromobox protein homolog 1(CBX1) ELISA kit
E03C1420-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Chromobox protein homolog 1(CBX1) ELISA kit
E03C1420-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Chromobox protein homolog 1(CBX1) ELISA kit
E03C1420-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit
E03S0269-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit
E03S0269-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Mothers Against Decapentaplegic Homolog 1 ELISA kit
E03S0269-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Mothers Against Decapentaplegic Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Fermt1/ Fermitin family homolog 1 ELISA Kit
E0522Mo 1 Kit
EUR 632
ELISA kit for Mouse Fermitin family homolog 1
EK3461 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Fermitin family homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Mouse Chromobox protein homolog 1, Cbx1 ELISA KIT
ELI-10762m 96 Tests
EUR 865
Mouse Protein misato homolog 1, Msto1 ELISA KIT
ELI-12984m 96 Tests
EUR 865
Mouse Protein Hook homolog 1, Hook1 ELISA KIT
ELI-13075m 96 Tests
EUR 865
Mouse Slit homolog 1 protein, Slit1 ELISA KIT
ELI-18718m 96 Tests
EUR 865
Mouse Single- minded homolog 1, Sim1 ELISA KIT
ELI-19165m 96 Tests
EUR 865

Mouse EGLN1(Egl Nine Homolog 1) ELISA Kit